Mutagenetix > Incidental Mutations

Incidental Mutation 'V7583:Zfp292'

152641

Institutional Source

Beutler Lab

Gene Symbol

Zfp292

Ensembl Gene

ENSMUSG00000039967

Gene Name

zinc finger protein 292

Synonyms

Zn-16, 5730450D02Rik, Zfp15, Zn-15, Zfp-15, 9430062L07Rik, Krox-10

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.561) question?

Stock #

V7583 () of strain stinger

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34803113-34882960 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 34806783 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 2087 (C2087Y)

Ref Sequence

ENSEMBL: ENSMUSP00000095766 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047950] [ENSMUST00000098163]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047950
AA Change: C2092Y

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000037233
Gene: ENSMUSG00000039967
AA Change: C2092Y

Domain	Start	End	E-Value	Type
low complexity region	19	39	N/A	INTRINSIC
low complexity region	101	120	N/A	INTRINSIC
low complexity region	512	523	N/A	INTRINSIC
ZnF_C2H2	540	561	5.12e1	SMART
ZnF_C2H2	567	589	4.72e-2	SMART
low complexity region	649	664	N/A	INTRINSIC
ZnF_C2H2	681	705	3.52e-1	SMART
ZnF_C2H2	722	744	1.53e-1	SMART
ZnF_C2H2	750	774	1.62e0	SMART
ZnF_C2H2	779	803	1.08e1	SMART
ZnF_C2H2	807	831	1.95e-3	SMART
low complexity region	1062	1078	N/A	INTRINSIC
ZnF_C2H2	1085	1110	7.67e-2	SMART
ZnF_C2H2	1361	1381	1.93e2	SMART
low complexity region	1606	1618	N/A	INTRINSIC
ZnF_C2H2	1879	1904	4.4e-2	SMART
ZnF_C2H2	1924	1949	5.42e-2	SMART
low complexity region	2004	2014	N/A	INTRINSIC
low complexity region	2024	2037	N/A	INTRINSIC
coiled coil region	2050	2072	N/A	INTRINSIC
ZnF_C2H2	2091	2116	4.45e0	SMART
low complexity region	2121	2143	N/A	INTRINSIC
ZnF_C2H2	2149	2174	1.64e-1	SMART
ZnF_C2H2	2193	2218	3.24e0	SMART
ZnF_C2H2	2233	2258	1.18e-2	SMART
low complexity region	2301	2314	N/A	INTRINSIC
ZnF_C2H2	2362	2386	2.86e-1	SMART
low complexity region	2589	2605	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098163
AA Change: C2087Y

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000095766
Gene: ENSMUSG00000039967
AA Change: C2087Y

Domain	Start	End	E-Value	Type
low complexity region	19	39	N/A	INTRINSIC
low complexity region	101	120	N/A	INTRINSIC
low complexity region	507	518	N/A	INTRINSIC
ZnF_C2H2	535	556	5.12e1	SMART
ZnF_C2H2	562	584	4.72e-2	SMART
low complexity region	644	659	N/A	INTRINSIC
ZnF_C2H2	676	700	3.52e-1	SMART
ZnF_C2H2	717	739	1.53e-1	SMART
ZnF_C2H2	745	769	1.62e0	SMART
ZnF_C2H2	774	798	1.08e1	SMART
ZnF_C2H2	802	826	1.95e-3	SMART
low complexity region	1057	1073	N/A	INTRINSIC
ZnF_C2H2	1080	1105	7.67e-2	SMART
ZnF_C2H2	1356	1376	1.93e2	SMART
low complexity region	1601	1613	N/A	INTRINSIC
ZnF_C2H2	1874	1899	4.4e-2	SMART
ZnF_C2H2	1919	1944	5.42e-2	SMART
low complexity region	1999	2009	N/A	INTRINSIC
low complexity region	2019	2032	N/A	INTRINSIC
coiled coil region	2045	2067	N/A	INTRINSIC
ZnF_C2H2	2086	2111	4.45e0	SMART
low complexity region	2116	2138	N/A	INTRINSIC
ZnF_C2H2	2144	2169	1.64e-1	SMART
ZnF_C2H2	2188	2213	3.24e0	SMART
ZnF_C2H2	2228	2253	1.18e-2	SMART
low complexity region	2296	2309	N/A	INTRINSIC
ZnF_C2H2	2357	2381	2.86e-1	SMART
low complexity region	2584	2600	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530002B09Rik	A	T	4: 122,701,257	H102L	possibly damaging	Het
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Cdc42bpb	C	T	12: 111,296,391	G1501S	probably benign	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dcaf4	C	A	12: 83,537,701		probably null	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Dpyd	C	T	3: 118,897,126	Q295*	probably null	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Fcgr1	T	C	3: 96,284,276	*405W	probably null	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Golga4	A	G	9: 118,556,075	E727G	possibly damaging	Het
Hnrnpab	A	T	11: 51,602,624	N252K	probably benign	Het
Ing1	T	C	8: 11,561,934	V124A	probably damaging	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Lrp4	C	T	2: 91,488,518	S900L	possibly damaging	Het
Mbd5	A	G	2: 49,316,410	D1713G	probably damaging	Het
Muc6	T	G	7: 141,647,613	E808A	probably benign	Het
Mylk	G	T	16: 34,995,204		probably null	Het
Nbeal2	A	G	9: 110,637,937	V670A	possibly damaging	Het
Nphp3	T	C	9: 104,035,894		probably null	Het
Numbl	T	C	7: 27,279,602	S379P	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Pelp1	T	A	11: 70,398,150	T257S	probably damaging	Het
Pigx	T	C	16: 32,087,422	D129G	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Plekhb1	T	C	7: 100,654,618	T112A	probably benign	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Ror1	A	G	4: 100,440,933	Q501R	probably damaging	Het
Sirpb1b	A	G	3: 15,503,183	V366A	probably benign	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Spata31	C	A	13: 64,921,648	P537T	probably benign	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Toe1	A	T	4: 116,806,111	N56K	probably damaging	Het
Tprkb	A	G	6: 85,928,782	K150E	probably damaging	Het
Trps1	T	C	15: 50,831,577	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Vps18	A	G	2: 119,297,228	Y844C	probably benign	Het
Wdr60	A	C	12: 116,211,840	S906A	possibly damaging	Het
Wdr72	T	A	9: 74,157,270	I528N	probably damaging	Het
Zfp933	G	A	4: 147,826,470	A223V	probably damaging	Het
Zmynd8	G	A	2: 165,812,394	R724*	probably null	Het

Other mutations in Zfp292

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Zfp292	APN	4	34808683	missense	probably benign	0.15
IGL00502:Zfp292	APN	4	34809775	missense	possibly damaging	0.63
IGL00539:Zfp292	APN	4	34808790	missense	probably damaging	0.98
IGL00676:Zfp292	APN	4	34807827	missense	probably damaging	0.99
IGL01068:Zfp292	APN	4	34806763	missense	probably damaging	1.00
IGL01311:Zfp292	APN	4	34807961	missense	probably benign	0.01
IGL01639:Zfp292	APN	4	34809048	missense	probably benign	0.04
IGL01688:Zfp292	APN	4	34807855	missense	possibly damaging	0.93
IGL02345:Zfp292	APN	4	34809244	missense	possibly damaging	0.94
IGL02444:Zfp292	APN	4	34808810	missense	possibly damaging	0.87
IGL02548:Zfp292	APN	4	34805416	missense	probably damaging	1.00
IGL02551:Zfp292	APN	4	34806462	missense	possibly damaging	0.93
IGL02702:Zfp292	APN	4	34809415	missense	probably benign	0.14
IGL02715:Zfp292	APN	4	34819542	missense	probably damaging	1.00
IGL03273:Zfp292	APN	4	34806163	missense	probably benign	0.00
F5770:Zfp292	UTSW	4	34806783	missense	possibly damaging	0.85
PIT4362001:Zfp292	UTSW	4	34807524	missense	probably benign	0.00
R0153:Zfp292	UTSW	4	34811185	missense	probably benign	0.26
R0184:Zfp292	UTSW	4	34819563	missense	probably damaging	1.00
R0295:Zfp292	UTSW	4	34806281	missense	probably damaging	1.00
R0367:Zfp292	UTSW	4	34808227	missense	probably benign	0.25
R0433:Zfp292	UTSW	4	34839959	missense	probably damaging	0.99
R0481:Zfp292	UTSW	4	34810059	missense	probably benign	0.28
R0555:Zfp292	UTSW	4	34807194	missense	probably damaging	1.00
R0597:Zfp292	UTSW	4	34807399	missense	probably benign	0.02
R0748:Zfp292	UTSW	4	34816424	splice site	probably benign
R0782:Zfp292	UTSW	4	34839382	missense	possibly damaging	0.94
R0834:Zfp292	UTSW	4	34809114	missense	probably benign	0.00
R0879:Zfp292	UTSW	4	34811218	missense	probably benign	0.00
R1083:Zfp292	UTSW	4	34807569	missense	probably damaging	0.98
R1343:Zfp292	UTSW	4	34805238	missense	probably damaging	0.98
R1498:Zfp292	UTSW	4	34805397	missense	possibly damaging	0.88
R1714:Zfp292	UTSW	4	34808935	missense	probably damaging	1.00
R1724:Zfp292	UTSW	4	34811237	missense	probably damaging	1.00
R1755:Zfp292	UTSW	4	34811043	missense	probably benign	0.02
R1837:Zfp292	UTSW	4	34810264	missense	probably damaging	0.98
R1914:Zfp292	UTSW	4	34805100	missense	possibly damaging	0.92
R1915:Zfp292	UTSW	4	34805100	missense	possibly damaging	0.92
R1936:Zfp292	UTSW	4	34807452	missense	probably benign	0.22
R2107:Zfp292	UTSW	4	34808593	missense	possibly damaging	0.86
R2108:Zfp292	UTSW	4	34808593	missense	possibly damaging	0.86
R2136:Zfp292	UTSW	4	34810266	missense	probably benign	0.13
R2182:Zfp292	UTSW	4	34807417	missense	probably damaging	1.00
R2186:Zfp292	UTSW	4	34807962	missense	probably benign	0.07
R2306:Zfp292	UTSW	4	34809468	missense	probably damaging	0.96
R2350:Zfp292	UTSW	4	34811281	missense	probably damaging	1.00
R2382:Zfp292	UTSW	4	34806426	missense	possibly damaging	0.91
R2872:Zfp292	UTSW	4	34808595	missense	probably damaging	1.00
R2872:Zfp292	UTSW	4	34808595	missense	probably damaging	1.00
R3018:Zfp292	UTSW	4	34808814	missense	probably damaging	0.99
R3812:Zfp292	UTSW	4	34810326	missense	probably damaging	0.98
R4006:Zfp292	UTSW	4	34807744	missense	probably benign	0.00
R4006:Zfp292	UTSW	4	34809611	missense	possibly damaging	0.62
R4060:Zfp292	UTSW	4	34810863	missense	probably damaging	1.00
R4062:Zfp292	UTSW	4	34810863	missense	probably damaging	1.00
R4063:Zfp292	UTSW	4	34810863	missense	probably damaging	1.00
R4064:Zfp292	UTSW	4	34810863	missense	probably damaging	1.00
R4207:Zfp292	UTSW	4	34806079	missense	probably benign	0.04
R4641:Zfp292	UTSW	4	34807828	missense	probably damaging	0.99
R4684:Zfp292	UTSW	4	34807078	missense	probably benign	0.00
R4718:Zfp292	UTSW	4	34819521	missense	possibly damaging	0.92
R4865:Zfp292	UTSW	4	34819563	missense	probably damaging	1.00
R4870:Zfp292	UTSW	4	34808917	missense	probably damaging	1.00
R5097:Zfp292	UTSW	4	34839878	missense	possibly damaging	0.89
R5233:Zfp292	UTSW	4	34809755	missense	probably damaging	1.00
R5246:Zfp292	UTSW	4	34805842	missense	possibly damaging	0.76
R5369:Zfp292	UTSW	4	34807491	missense	possibly damaging	0.89
R5527:Zfp292	UTSW	4	34806261	missense	probably damaging	1.00
R5621:Zfp292	UTSW	4	34811703	missense	probably damaging	0.98
R5770:Zfp292	UTSW	4	34806747	missense	probably damaging	1.00
R5900:Zfp292	UTSW	4	34805125	missense	probably damaging	1.00
R5905:Zfp292	UTSW	4	34819549	missense	probably damaging	1.00
R5994:Zfp292	UTSW	4	34805464	missense	possibly damaging	0.87
R6028:Zfp292	UTSW	4	34819549	missense	probably damaging	1.00
R6056:Zfp292	UTSW	4	34809784	missense	probably damaging	1.00
R6093:Zfp292	UTSW	4	34811902	missense	probably damaging	1.00
R6126:Zfp292	UTSW	4	34808497	missense	probably benign	0.13
R6209:Zfp292	UTSW	4	34809442	missense	probably benign	0.14
R6275:Zfp292	UTSW	4	34808883	missense	possibly damaging	0.93
R6523:Zfp292	UTSW	4	34816301	missense	probably benign	0.21
R6747:Zfp292	UTSW	4	34806894	missense	probably damaging	0.97
R6752:Zfp292	UTSW	4	34808593	missense	possibly damaging	0.86
R6967:Zfp292	UTSW	4	34807812	missense	probably damaging	1.00
R7038:Zfp292	UTSW	4	34816357	missense	probably damaging	1.00
R7056:Zfp292	UTSW	4	34809784	missense	probably damaging	1.00
R7088:Zfp292	UTSW	4	34806796	missense	probably damaging	1.00
R7158:Zfp292	UTSW	4	34808679	missense	probably benign
R7254:Zfp292	UTSW	4	34819476	missense	probably damaging	0.98
R7350:Zfp292	UTSW	4	34806839	missense	probably benign
R7378:Zfp292	UTSW	4	34808384	missense	probably benign	0.26
R7535:Zfp292	UTSW	4	34811487	missense	probably benign	0.28
R7589:Zfp292	UTSW	4	34806777	missense	probably damaging	1.00
R7816:Zfp292	UTSW	4	34809865	missense	probably benign	0.02
R7979:Zfp292	UTSW	4	34809198	missense	probably benign	0.02
R7997:Zfp292	UTSW	4	34808688	missense	probably damaging	0.96
R8129:Zfp292	UTSW	4	34807386	missense	probably damaging	1.00
R8211:Zfp292	UTSW	4	34806163	missense	probably benign	0.00
R8302:Zfp292	UTSW	4	34810893	missense	possibly damaging	0.64
R8500:Zfp292	UTSW	4	34826691	critical splice donor site	probably null
R8709:Zfp292	UTSW	4	34805982	missense	probably damaging	1.00
V7580:Zfp292	UTSW	4	34806783	missense	possibly damaging	0.85
V7581:Zfp292	UTSW	4	34806783	missense	possibly damaging	0.85
V7582:Zfp292	UTSW	4	34806783	missense	possibly damaging	0.85
Z1177:Zfp292	UTSW	4	34811058	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGGAAATTTGCCAACATCCACAGC -3'
(R):5'- ACCAGAAAGTTCTTCACAGCCTGTC -3'

Sequencing Primer
(F):5'- ACAGCAGCAGTCATGCTTTC -3'
(R):5'- ACAGCCTGTCACATCTTCTG -3'

Posted On

2014-01-29