Mutagenetix > Incidental Mutations

Incidental Mutation 'V7583:Ror1'

152643

Institutional Source

Beutler Lab

Gene Symbol

Ror1

Ensembl Gene

ENSMUSG00000035305

Gene Name

receptor tyrosine kinase-like orphan receptor 1

Synonyms

2810404D04Rik, Ntrkr1

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

V7583 () of strain stinger

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

100095791-100444765 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100440933 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 501 (Q501R)

Ref Sequence

ENSEMBL: ENSMUSP00000048171 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039630]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039630
AA Change: Q501R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000048171
Gene: ENSMUSG00000035305
AA Change: Q501R

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
IGc2	70	138	8.37e-15	SMART
Pfam:Fz	170	290	4.9e-13	PFAM
KR	311	393	7.57e-47	SMART
transmembrane domain	404	426	N/A	INTRINSIC
TyrKc	473	746	2.46e-137	SMART
low complexity region	753	762	N/A	INTRINSIC
low complexity region	817	828	N/A	INTRINSIC
low complexity region	849	864	N/A	INTRINSIC

Meta Mutation Damage Score

0.1597

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a receptor tyrosine kinase that has been implicated in nervous system development, specifically in the maintenance of neural progenitor cell fate, neurite extension and synapse formation. The encoded protein, likely a pseudokinase that lacks catalytic activity, may also regulate adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first day after birth from respiratory defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530002B09Rik	A	T	4: 122,701,257	H102L	possibly damaging	Het
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Cdc42bpb	C	T	12: 111,296,391	G1501S	probably benign	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dcaf4	C	A	12: 83,537,701		probably null	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Dpyd	C	T	3: 118,897,126	Q295*	probably null	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Fcgr1	T	C	3: 96,284,276	*405W	probably null	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Golga4	A	G	9: 118,556,075	E727G	possibly damaging	Het
Hnrnpab	A	T	11: 51,602,624	N252K	probably benign	Het
Ing1	T	C	8: 11,561,934	V124A	probably damaging	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Lrp4	C	T	2: 91,488,518	S900L	possibly damaging	Het
Mbd5	A	G	2: 49,316,410	D1713G	probably damaging	Het
Muc6	T	G	7: 141,647,613	E808A	probably benign	Het
Mylk	G	T	16: 34,995,204		probably null	Het
Nbeal2	A	G	9: 110,637,937	V670A	possibly damaging	Het
Nphp3	T	C	9: 104,035,894		probably null	Het
Numbl	T	C	7: 27,279,602	S379P	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Pelp1	T	A	11: 70,398,150	T257S	probably damaging	Het
Pigx	T	C	16: 32,087,422	D129G	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Plekhb1	T	C	7: 100,654,618	T112A	probably benign	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Sirpb1b	A	G	3: 15,503,183	V366A	probably benign	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Spata31	C	A	13: 64,921,648	P537T	probably benign	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Toe1	A	T	4: 116,806,111	N56K	probably damaging	Het
Tprkb	A	G	6: 85,928,782	K150E	probably damaging	Het
Trps1	T	C	15: 50,831,577	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Vps18	A	G	2: 119,297,228	Y844C	probably benign	Het
Wdr60	A	C	12: 116,211,840	S906A	possibly damaging	Het
Wdr72	T	A	9: 74,157,270	I528N	probably damaging	Het
Zfp292	C	T	4: 34,806,783	C2087Y	possibly damaging	Het
Zfp933	G	A	4: 147,826,470	A223V	probably damaging	Het
Zmynd8	G	A	2: 165,812,394	R724*	probably null	Het

Other mutations in Ror1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Ror1	APN	4	100333743	missense	probably damaging	1.00
IGL00939:Ror1	APN	4	100441226	missense	probably benign	0.01
IGL01408:Ror1	APN	4	100333787	missense	probably damaging	1.00
IGL01678:Ror1	APN	4	100425968	missense	possibly damaging	0.68
IGL01700:Ror1	APN	4	100409771	missense	probably damaging	1.00
IGL01985:Ror1	APN	4	100425964	missense	possibly damaging	0.94
IGL02002:Ror1	APN	4	100441184	missense	probably damaging	1.00
IGL02634:Ror1	APN	4	100426110	missense	probably benign	0.00
IGL02995:Ror1	APN	4	100334525	splice site	probably benign
IGL03033:Ror1	APN	4	100411895	missense	possibly damaging	0.67
IGL03207:Ror1	APN	4	100407945	splice site	probably null
F5770:Ror1	UTSW	4	100440933	missense	probably damaging	0.99
R0256:Ror1	UTSW	4	100409745	missense	probably benign	0.20
R0417:Ror1	UTSW	4	100412000	missense	possibly damaging	0.94
R0525:Ror1	UTSW	4	100441520	missense	probably damaging	1.00
R1034:Ror1	UTSW	4	100333620	nonsense	probably null
R1278:Ror1	UTSW	4	100441878	missense	possibly damaging	0.69
R1368:Ror1	UTSW	4	100441137	missense	possibly damaging	0.94
R1437:Ror1	UTSW	4	100412109	missense	probably benign
R1441:Ror1	UTSW	4	100440983	missense	probably benign
R1544:Ror1	UTSW	4	100441986	missense	probably damaging	1.00
R1717:Ror1	UTSW	4	100302938	missense	probably benign
R1857:Ror1	UTSW	4	100441503	missense	probably damaging	1.00
R2018:Ror1	UTSW	4	100407841	nonsense	probably null
R2051:Ror1	UTSW	4	100407868	nonsense	probably null
R2127:Ror1	UTSW	4	100442093	missense	probably benign
R2132:Ror1	UTSW	4	100410025	missense	probably benign	0.35
R2133:Ror1	UTSW	4	100410025	missense	probably benign	0.35
R2176:Ror1	UTSW	4	100441874	missense	probably damaging	0.99
R2431:Ror1	UTSW	4	100441155	missense	probably damaging	1.00
R2896:Ror1	UTSW	4	100096280	missense	unknown
R3005:Ror1	UTSW	4	100441764	missense	probably damaging	0.99
R3780:Ror1	UTSW	4	100412117	missense	probably benign	0.34
R3850:Ror1	UTSW	4	100442160	missense	possibly damaging	0.90
R3861:Ror1	UTSW	4	100407923	missense	possibly damaging	0.46
R4599:Ror1	UTSW	4	100407910	missense	probably damaging	0.99
R4863:Ror1	UTSW	4	100409804	missense	probably damaging	0.99
R4871:Ror1	UTSW	4	100425998	missense	probably benign
R4990:Ror1	UTSW	4	100441964	missense	probably benign
R5023:Ror1	UTSW	4	100425932	missense	probably benign	0.01
R5028:Ror1	UTSW	4	100411936	missense	possibly damaging	0.67
R5079:Ror1	UTSW	4	100441422	missense	probably damaging	1.00
R5294:Ror1	UTSW	4	100425938	missense	probably benign	0.00
R5538:Ror1	UTSW	4	100441011	missense	probably benign
R6339:Ror1	UTSW	4	100411931	missense	possibly damaging	0.91
R6491:Ror1	UTSW	4	100409912	missense	possibly damaging	0.94
R6632:Ror1	UTSW	4	100442106	missense	probably benign
R6733:Ror1	UTSW	4	100426055	missense	probably benign
R7022:Ror1	UTSW	4	100407911	missense	probably damaging	1.00
R7054:Ror1	UTSW	4	100442239	missense	probably benign	0.00
R7121:Ror1	UTSW	4	100302945	missense	probably benign	0.00
R7350:Ror1	UTSW	4	100425943	missense	probably benign	0.00
R7492:Ror1	UTSW	4	100441059	missense	probably benign	0.22
R7502:Ror1	UTSW	4	100333630	missense	probably benign	0.03
R7531:Ror1	UTSW	4	100441191	missense	probably damaging	1.00
R7661:Ror1	UTSW	4	100441490	missense	probably damaging	1.00
R7822:Ror1	UTSW	4	100441367	missense	probably damaging	1.00
R7831:Ror1	UTSW	4	100441098	missense	probably benign	0.01
R7914:Ror1	UTSW	4	100441098	missense	probably benign	0.01
V7580:Ror1	UTSW	4	100440933	missense	probably damaging	0.99
X0020:Ror1	UTSW	4	100426090	missense	probably benign	0.02
Z1177:Ror1	UTSW	4	100302919	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCGTCGTACCATTACCTTCAGCAC -3'
(R):5'- TTCATCACTGCTACAGCCGACATC -3'

Sequencing Primer
(F):5'- ACCTTCAGCACAAGTATCCTATCTG -3'
(R):5'- TACAGCCGACATCGGAATG -3'

Posted On

2014-01-29