Incidental Mutation 'V7583:Numbl'
ID152650
Institutional Source Beutler Lab
Gene Symbol Numbl
Ensembl Gene ENSMUSG00000063160
Gene Namenumb-like
Synonymsnbl
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #V7583 () of strain stinger
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location27258433-27282144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27279602 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 379 (S379P)
Ref Sequence ENSEMBL: ENSMUSP00000078245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079258]
Predicted Effect probably benign
Transcript: ENSMUST00000079258
AA Change: S379P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078245
Gene: ENSMUSG00000063160
AA Change: S379P

DomainStartEndE-ValueType
PTB 75 205 1.11e-38 SMART
low complexity region 234 260 N/A INTRINSIC
Pfam:NumbF 287 371 3.5e-32 PFAM
coiled coil region 417 444 N/A INTRINSIC
low complexity region 532 574 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149805
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and exhibit no overt phenotypes except for a reduction in female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dcaf4 C A 12: 83,537,701 probably null Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Golga4 A G 9: 118,556,075 E727G possibly damaging Het
Hnrnpab A T 11: 51,602,624 N252K probably benign Het
Ing1 T C 8: 11,561,934 V124A probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Mbd5 A G 2: 49,316,410 D1713G probably damaging Het
Muc6 T G 7: 141,647,613 E808A probably benign Het
Mylk G T 16: 34,995,204 probably null Het
Nbeal2 A G 9: 110,637,937 V670A possibly damaging Het
Nphp3 T C 9: 104,035,894 probably null Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Sirpb1b A G 3: 15,503,183 V366A probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Vps18 A G 2: 119,297,228 Y844C probably benign Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Wdr72 T A 9: 74,157,270 I528N probably damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Numbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Numbl APN 7 27268810 missense possibly damaging 0.50
IGL01389:Numbl APN 7 27281047 missense possibly damaging 0.94
IGL02671:Numbl APN 7 27264902 missense probably damaging 1.00
F5770:Numbl UTSW 7 27279602 missense probably benign
R0212:Numbl UTSW 7 27280759 missense probably damaging 1.00
R0709:Numbl UTSW 7 27273990 missense probably damaging 1.00
R1768:Numbl UTSW 7 27280954 missense probably benign
R2181:Numbl UTSW 7 27268921 critical splice donor site probably null
R5071:Numbl UTSW 7 27280990 missense probably damaging 1.00
R5072:Numbl UTSW 7 27280990 missense probably damaging 1.00
R5074:Numbl UTSW 7 27280990 missense probably damaging 1.00
R6134:Numbl UTSW 7 27281314 missense probably damaging 0.98
R6387:Numbl UTSW 7 27276690 missense probably damaging 0.99
R6989:Numbl UTSW 7 27280840 missense probably damaging 1.00
R7510:Numbl UTSW 7 27271987 intron probably null
R8093:Numbl UTSW 7 27281036 missense possibly damaging 0.52
V7580:Numbl UTSW 7 27279602 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATCGGTTATCAGATGCCACCTAC -3'
(R):5'- TGGTCCCACAGTCCTAAGGCAATAC -3'

Sequencing Primer
(F):5'- GTGACCTATGTACCTCTGGAAGAC -3'
(R):5'- GTCCTAAGGCAATACAGTGGTTC -3'
Posted On2014-01-29