Incidental Mutation 'V7583:Izumo4'
ID 152661
Institutional Source Beutler Lab
Gene Symbol Izumo4
Ensembl Gene ENSMUSG00000055862
Gene Name IZUMO family member 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # V7583 () of strain stinger
Quality Score 206
Status Not validated
Chromosome 10
Chromosomal Location 80702184-80705373 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80703891 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 155 (T155S)
Ref Sequence ENSEMBL: ENSMUSP00000151397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003438] [ENSMUST00000020420] [ENSMUST00000218090] [ENSMUST00000218184] [ENSMUST00000218610]
AlphaFold D3Z690
Predicted Effect probably benign
Transcript: ENSMUST00000003438
SMART Domains Protein: ENSMUSP00000003438
Gene: ENSMUSG00000003348

DomainStartEndE-ValueType
Mob1_phocein 34 208 6.02e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020420
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000095426
AA Change: T152S
SMART Domains Protein: ENSMUSP00000093076
Gene: ENSMUSG00000055862
AA Change: T152S

DomainStartEndE-ValueType
Pfam:IZUMO 26 167 1.1e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218058
Predicted Effect probably benign
Transcript: ENSMUST00000218090
Predicted Effect probably benign
Transcript: ENSMUST00000218184
AA Change: T155S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect unknown
Transcript: ENSMUST00000218330
AA Change: T65S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218538
Predicted Effect probably benign
Transcript: ENSMUST00000218610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219746
Meta Mutation Damage Score 0.0762 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dcaf4 C A 12: 83,537,701 probably null Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Golga4 A G 9: 118,556,075 E727G possibly damaging Het
Hnrnpab A T 11: 51,602,624 N252K probably benign Het
Ing1 T C 8: 11,561,934 V124A probably damaging Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Mbd5 A G 2: 49,316,410 D1713G probably damaging Het
Muc6 T G 7: 141,647,613 E808A probably benign Het
Mylk G T 16: 34,995,204 probably null Het
Nbeal2 A G 9: 110,637,937 V670A possibly damaging Het
Nphp3 T C 9: 104,035,894 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Sirpb1b A G 3: 15,503,183 V366A probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Vps18 A G 2: 119,297,228 Y844C probably benign Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Wdr72 T A 9: 74,157,270 I528N probably damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Izumo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02850:Izumo4 APN 10 80704198 unclassified probably benign
IGL03019:Izumo4 APN 10 80703846 unclassified probably benign
IGL03391:Izumo4 APN 10 80705113 missense probably damaging 0.97
F5770:Izumo4 UTSW 10 80703891 missense probably benign 0.02
IGL02835:Izumo4 UTSW 10 80705125 missense probably benign
R0304:Izumo4 UTSW 10 80702936 missense probably damaging 1.00
R0377:Izumo4 UTSW 10 80702840 missense probably damaging 1.00
R0411:Izumo4 UTSW 10 80703084 missense probably damaging 0.99
R0498:Izumo4 UTSW 10 80704196 critical splice donor site probably null
R1822:Izumo4 UTSW 10 80703895 missense probably damaging 1.00
R1870:Izumo4 UTSW 10 80703735 missense probably damaging 1.00
R1977:Izumo4 UTSW 10 80703121 missense probably damaging 1.00
R2237:Izumo4 UTSW 10 80702830 missense probably damaging 1.00
R5288:Izumo4 UTSW 10 80702805 nonsense probably null
R5543:Izumo4 UTSW 10 80702834 missense probably damaging 1.00
R5587:Izumo4 UTSW 10 80703220 missense probably damaging 1.00
R6199:Izumo4 UTSW 10 80702873 missense probably damaging 1.00
R6222:Izumo4 UTSW 10 80703051 missense probably damaging 1.00
R6349:Izumo4 UTSW 10 80702717 start codon destroyed probably null 0.02
R8264:Izumo4 UTSW 10 80702738 missense
V7580:Izumo4 UTSW 10 80703891 missense probably benign 0.02
V7581:Izumo4 UTSW 10 80703891 missense probably benign 0.02
V7582:Izumo4 UTSW 10 80703891 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCAGCGTCACTGTGGTAAGTGAAC -3'
(R):5'- ACAACCTTGGATTCCAGCAGGAAC -3'

Sequencing Primer
(F):5'- TCTGGGGCTGCTTCTCATAT -3'
(R):5'- ACAAGACTTGGTGGTGGGGTA -3'
Posted On 2014-01-29