Incidental Mutation 'V7583:Hnrnpab'
ID152662
Institutional Source Beutler Lab
Gene Symbol Hnrnpab
Ensembl Gene ENSMUSG00000020358
Gene Nameheterogeneous nuclear ribonucleoprotein A/B
SynonymsCBF-A, Hnrpab, Cgbfa
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.798) question?
Stock #V7583 () of strain stinger
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location51600100-51606847 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51602624 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 252 (N252K)
Ref Sequence ENSEMBL: ENSMUSP00000074238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020625] [ENSMUST00000074669] [ENSMUST00000101249] [ENSMUST00000101250] [ENSMUST00000109103] [ENSMUST00000167797]
Predicted Effect probably benign
Transcript: ENSMUST00000020625
SMART Domains Protein: ENSMUSP00000020625
Gene: ENSMUSG00000020359

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Aminotran_3 27 433 2.1e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074669
AA Change: N252K

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000074238
Gene: ENSMUSG00000020358
AA Change: N252K

DomainStartEndE-ValueType
low complexity region 21 55 N/A INTRINSIC
RRM 76 148 3.59e-25 SMART
RRM 160 232 5.79e-20 SMART
low complexity region 240 270 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000101249
AA Change: N252K
SMART Domains Protein: ENSMUSP00000098807
Gene: ENSMUSG00000020358
AA Change: N252K

DomainStartEndE-ValueType
low complexity region 21 55 N/A INTRINSIC
RRM 76 148 3.59e-25 SMART
RRM 160 232 5.79e-20 SMART
low complexity region 240 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101250
SMART Domains Protein: ENSMUSP00000098808
Gene: ENSMUSG00000020359

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Aminotran_3 33 212 8.2e-29 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000109103
AA Change: N252K
SMART Domains Protein: ENSMUSP00000104731
Gene: ENSMUSG00000020358
AA Change: N252K

DomainStartEndE-ValueType
Pfam:CBFNT 1 75 5.7e-23 PFAM
RRM 76 148 3.59e-25 SMART
RRM 160 232 5.79e-20 SMART
low complexity region 240 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167797
SMART Domains Protein: ENSMUSP00000132190
Gene: ENSMUSG00000020359

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Aminotran_3 33 373 1.5e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169995
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein with consensus RNA binding domains present in a number of other RNA binding proteins and a glycine-rich C-terminus. This gene overlaps in a tail-to-tail orientation the gene encoding alanine-glyoxylate aminotransferase 2-like 2. Some of the exons of this gene are interspersed with exons of alanine-glyoxylate aminotransferase 2-like 2. Two alternatively spliced transcript variants that encode distinct proteins have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron differentiation, increased susceptibility to neuronal excitotoxicity and long neurites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dcaf4 C A 12: 83,537,701 probably null Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Golga4 A G 9: 118,556,075 E727G possibly damaging Het
Ing1 T C 8: 11,561,934 V124A probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Mbd5 A G 2: 49,316,410 D1713G probably damaging Het
Muc6 T G 7: 141,647,613 E808A probably benign Het
Mylk G T 16: 34,995,204 probably null Het
Nbeal2 A G 9: 110,637,937 V670A possibly damaging Het
Nphp3 T C 9: 104,035,894 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Sirpb1b A G 3: 15,503,183 V366A probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Vps18 A G 2: 119,297,228 Y844C probably benign Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Wdr72 T A 9: 74,157,270 I528N probably damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Hnrnpab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Hnrnpab APN 11 51601795 intron probably benign
IGL02806:Hnrnpab APN 11 51605478 missense probably benign 0.03
F5770:Hnrnpab UTSW 11 51602624 missense probably benign 0.39
R0172:Hnrnpab UTSW 11 51602667 missense probably damaging 0.99
R3619:Hnrnpab UTSW 11 51602611 missense possibly damaging 0.73
R3747:Hnrnpab UTSW 11 51602646 missense probably benign 0.04
R5489:Hnrnpab UTSW 11 51604813 missense probably damaging 1.00
R5854:Hnrnpab UTSW 11 51604681 missense probably damaging 1.00
R5910:Hnrnpab UTSW 11 51601454 missense probably benign
R6901:Hnrnpab UTSW 11 51601848 intron probably benign
R7652:Hnrnpab UTSW 11 51605573 missense probably damaging 0.99
R7766:Hnrnpab UTSW 11 51601466 missense unknown
V7581:Hnrnpab UTSW 11 51602624 missense probably benign 0.39
X0025:Hnrnpab UTSW 11 51604729 missense probably damaging 1.00
X0064:Hnrnpab UTSW 11 51601801 intron probably benign
Z1088:Hnrnpab UTSW 11 51601746 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCATGAAGCCATGAGCCATAGCAG -3'
(R):5'- ATCCAGTGAAGCCTCACACACTTG -3'

Sequencing Primer
(F):5'- TGAGCCATAGCAGCACAAG -3'
(R):5'- GAAGCCTCACACACTTGTTTTATCTG -3'
Posted On2014-01-29