Incidental Mutation 'V7583:Dcaf4'
Institutional Source Beutler Lab
Gene Symbol Dcaf4
Ensembl Gene ENSMUSG00000021222
Gene NameDDB1 and CUL4 associated factor 4
Synonyms1110018E21Rik, Wdr21
Accession Numbers

Genbank: NM_030246; MGI: 1921078

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #V7583 () of strain stinger
Quality Score225
Status Not validated
Chromosomal Location83520466-83541920 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 83537701 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021645] [ENSMUST00000021645] [ENSMUST00000021645] [ENSMUST00000223291] [ENSMUST00000223291] [ENSMUST00000223291]
Predicted Effect probably null
Transcript: ENSMUST00000021645
SMART Domains Protein: ENSMUSP00000021645
Gene: ENSMUSG00000021222

low complexity region 8 16 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Blast:WD40 274 313 2e-14 BLAST
WD40 361 399 8.36e-2 SMART
WD40 402 443 7.4e0 SMART
Blast:WD40 446 494 1e-15 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000021645
SMART Domains Protein: ENSMUSP00000021645
Gene: ENSMUSG00000021222

low complexity region 8 16 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Blast:WD40 274 313 2e-14 BLAST
WD40 361 399 8.36e-2 SMART
WD40 402 443 7.4e0 SMART
Blast:WD40 446 494 1e-15 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000021645
SMART Domains Protein: ENSMUSP00000021645
Gene: ENSMUSG00000021222

low complexity region 8 16 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Blast:WD40 274 313 2e-14 BLAST
WD40 361 399 8.36e-2 SMART
WD40 402 443 7.4e0 SMART
Blast:WD40 446 494 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222725
Predicted Effect probably null
Transcript: ENSMUST00000223291
Predicted Effect probably null
Transcript: ENSMUST00000223291
Predicted Effect probably null
Transcript: ENSMUST00000223291
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that interacts with the Cul4-Ddb1 E3 ligase macromolecular complex. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2009]
Allele List at MGI

All alleles(39) : Gene trapped(39)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Golga4 A G 9: 118,556,075 E727G possibly damaging Het
Hnrnpab A T 11: 51,602,624 N252K probably benign Het
Ing1 T C 8: 11,561,934 V124A probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Mbd5 A G 2: 49,316,410 D1713G probably damaging Het
Muc6 T G 7: 141,647,613 E808A probably benign Het
Mylk G T 16: 34,995,204 probably null Het
Nbeal2 A G 9: 110,637,937 V670A possibly damaging Het
Nphp3 T C 9: 104,035,894 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Sirpb1b A G 3: 15,503,183 V366A probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Vps18 A G 2: 119,297,228 Y844C probably benign Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Wdr72 T A 9: 74,157,270 I528N probably damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Dcaf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Dcaf4 APN 12 83539333 missense probably damaging 1.00
IGL01401:Dcaf4 APN 12 83541374 missense probably damaging 1.00
IGL02393:Dcaf4 APN 12 83530031 missense probably damaging 1.00
IGL02970:Dcaf4 APN 12 83529215 missense probably damaging 0.99
BB003:Dcaf4 UTSW 12 83533929 nonsense probably null
BB013:Dcaf4 UTSW 12 83533929 nonsense probably null
F5770:Dcaf4 UTSW 12 83537701 splice site probably null
PIT4504001:Dcaf4 UTSW 12 83534011 critical splice donor site probably null
R0032:Dcaf4 UTSW 12 83535988 splice site probably benign
R0032:Dcaf4 UTSW 12 83535988 splice site probably benign
R0164:Dcaf4 UTSW 12 83535988 splice site probably benign
R0165:Dcaf4 UTSW 12 83535988 splice site probably benign
R0167:Dcaf4 UTSW 12 83535988 splice site probably benign
R0211:Dcaf4 UTSW 12 83535961 missense probably damaging 1.00
R0211:Dcaf4 UTSW 12 83535961 missense probably damaging 1.00
R0594:Dcaf4 UTSW 12 83538043 critical splice donor site probably null
R1191:Dcaf4 UTSW 12 83535967 missense probably damaging 1.00
R4499:Dcaf4 UTSW 12 83539360 missense probably damaging 1.00
R4896:Dcaf4 UTSW 12 83539459 missense possibly damaging 0.86
R4932:Dcaf4 UTSW 12 83532304 missense possibly damaging 0.61
R5882:Dcaf4 UTSW 12 83539429 missense probably damaging 0.96
R7084:Dcaf4 UTSW 12 83537797 frame shift probably null
R7564:Dcaf4 UTSW 12 83541523 missense probably damaging 0.97
R7777:Dcaf4 UTSW 12 83537959 missense probably damaging 0.97
R7926:Dcaf4 UTSW 12 83533929 nonsense probably null
R8290:Dcaf4 UTSW 12 83541559 missense probably benign 0.32
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tgttgtaaatccaccattgcc -3'
Posted On2014-01-29