Incidental Mutation 'V7583:Wdr60'
ID152669
Institutional Source Beutler Lab
Gene Symbol Wdr60
Ensembl Gene ENSMUSG00000042050
Gene NameWD repeat domain 60
SynonymsD430033N04Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #V7583 () of strain stinger
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location116206262-116263022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 116211840 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 906 (S906A)
Ref Sequence ENSEMBL: ENSMUSP00000047334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039349]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039349
AA Change: S906A

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047334
Gene: ENSMUSG00000042050
AA Change: S906A

DomainStartEndE-ValueType
coiled coil region 84 122 N/A INTRINSIC
low complexity region 168 193 N/A INTRINSIC
low complexity region 226 242 N/A INTRINSIC
coiled coil region 280 309 N/A INTRINSIC
low complexity region 319 337 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
WD40 629 668 2.77e-1 SMART
Blast:WD40 694 755 2e-7 BLAST
WD40 846 881 3.84e0 SMART
WD40 884 926 5.55e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222764
Meta Mutation Damage Score 0.1360 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) and may facilitate the formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein contains four WD repeats and may play a role in the formation of cilia. Mutations in this gene have been associated with short-rib polydactyly and Jeune syndromes. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dcaf4 C A 12: 83,537,701 probably null Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Golga4 A G 9: 118,556,075 E727G possibly damaging Het
Hnrnpab A T 11: 51,602,624 N252K probably benign Het
Ing1 T C 8: 11,561,934 V124A probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Mbd5 A G 2: 49,316,410 D1713G probably damaging Het
Muc6 T G 7: 141,647,613 E808A probably benign Het
Mylk G T 16: 34,995,204 probably null Het
Nbeal2 A G 9: 110,637,937 V670A possibly damaging Het
Nphp3 T C 9: 104,035,894 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Sirpb1b A G 3: 15,503,183 V366A probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Vps18 A G 2: 119,297,228 Y844C probably benign Het
Wdr72 T A 9: 74,157,270 I528N probably damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Wdr60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Wdr60 APN 12 116241780 missense probably benign 0.01
IGL00668:Wdr60 APN 12 116257428 missense probably benign 0.32
IGL00914:Wdr60 APN 12 116232603 missense probably damaging 1.00
IGL01061:Wdr60 APN 12 116229704 missense probably benign 0.45
IGL01375:Wdr60 APN 12 116229676 missense possibly damaging 0.91
IGL01758:Wdr60 APN 12 116218798 missense possibly damaging 0.82
IGL01930:Wdr60 APN 12 116225963 critical splice donor site probably null
IGL02028:Wdr60 APN 12 116256061 missense probably benign 0.06
IGL03180:Wdr60 APN 12 116218865 missense probably benign 0.07
F5770:Wdr60 UTSW 12 116211840 missense possibly damaging 0.73
R0153:Wdr60 UTSW 12 116232636 missense probably benign 0.01
R0265:Wdr60 UTSW 12 116257406 splice site probably benign
R0364:Wdr60 UTSW 12 116257477 splice site probably benign
R0601:Wdr60 UTSW 12 116255935 missense possibly damaging 0.79
R0624:Wdr60 UTSW 12 116248290 missense probably damaging 0.98
R0755:Wdr60 UTSW 12 116211792 missense probably benign 0.01
R1023:Wdr60 UTSW 12 116232657 missense probably damaging 1.00
R1065:Wdr60 UTSW 12 116256076 missense probably damaging 0.98
R1543:Wdr60 UTSW 12 116231784 splice site probably benign
R1663:Wdr60 UTSW 12 116229610 missense probably benign 0.01
R1678:Wdr60 UTSW 12 116225970 missense probably damaging 1.00
R1719:Wdr60 UTSW 12 116255912 missense probably benign
R1755:Wdr60 UTSW 12 116226029 missense probably damaging 0.98
R1832:Wdr60 UTSW 12 116207743 missense probably damaging 0.99
R1918:Wdr60 UTSW 12 116232601 missense probably damaging 0.96
R2291:Wdr60 UTSW 12 116229571 splice site probably null
R2444:Wdr60 UTSW 12 116232669 missense possibly damaging 0.93
R3419:Wdr60 UTSW 12 116224977 missense probably benign 0.05
R3699:Wdr60 UTSW 12 116211842 nonsense probably null
R3700:Wdr60 UTSW 12 116211842 nonsense probably null
R4445:Wdr60 UTSW 12 116207715 missense probably damaging 1.00
R4664:Wdr60 UTSW 12 116256211 missense probably damaging 0.99
R4954:Wdr60 UTSW 12 116256025 missense probably damaging 1.00
R5057:Wdr60 UTSW 12 116213413 missense probably benign 0.43
R5163:Wdr60 UTSW 12 116255866 missense possibly damaging 0.76
R5341:Wdr60 UTSW 12 116255914 missense possibly damaging 0.51
R5560:Wdr60 UTSW 12 116218113 missense probably damaging 0.98
R5870:Wdr60 UTSW 12 116256245 missense possibly damaging 0.94
R5925:Wdr60 UTSW 12 116233394 missense possibly damaging 0.82
R6223:Wdr60 UTSW 12 116257458 missense possibly damaging 0.95
R6364:Wdr60 UTSW 12 116241732 missense probably damaging 1.00
R6450:Wdr60 UTSW 12 116246727 nonsense probably null
R6462:Wdr60 UTSW 12 116229631 missense probably benign
R6751:Wdr60 UTSW 12 116213456 missense possibly damaging 0.52
R6896:Wdr60 UTSW 12 116229671 missense possibly damaging 0.52
R6962:Wdr60 UTSW 12 116211778 missense probably damaging 1.00
R7033:Wdr60 UTSW 12 116211891 missense probably benign 0.03
R7042:Wdr60 UTSW 12 116254441 missense probably benign 0.02
R7254:Wdr60 UTSW 12 116262585 intron probably benign
R7567:Wdr60 UTSW 12 116254510 splice site probably null
R7889:Wdr60 UTSW 12 116255939 nonsense probably null
R7972:Wdr60 UTSW 12 116255939 nonsense probably null
V7581:Wdr60 UTSW 12 116211840 missense possibly damaging 0.73
V7582:Wdr60 UTSW 12 116211840 missense possibly damaging 0.73
X0063:Wdr60 UTSW 12 116255869 missense probably benign
Z1177:Wdr60 UTSW 12 116246099 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCAGCAGAGCACACATGGATG -3'
(R):5'- GAAAACTTCTCCTGGGTGTTAGGATGG -3'

Sequencing Primer
(F):5'- GGTCCAAGTACATATAGGACCTCTG -3'
(R):5'- CTCCTGGGTGTTAGGATGGAAATG -3'
Posted On2014-01-29