Mutagenetix > Incidental Mutation

Incidental Mutation 'V7583:Pigx'

152675

Institutional Source

Beutler Lab

Gene Symbol

Pigx

Ensembl Gene

ENSMUSG00000023791

Gene Name

phosphatidylinositol glycan anchor biosynthesis, class X

Synonyms

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.129) question?

Stock #

V7583 () of strain stinger

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32084416-32099740 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32087422 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 129 (D129G)

Ref Sequence

ENSEMBL: ENSMUSP00000141122 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096109] [ENSMUST00000133584] [ENSMUST00000136643] [ENSMUST00000147003] [ENSMUST00000147688] [ENSMUST00000155966] [ENSMUST00000189013] [ENSMUST00000215073] [ENSMUST00000232321]

AlphaFold

Q99LV7

Predicted Effect

probably damaging
Transcript: ENSMUST00000096109
AA Change: D131G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000093819
Gene: ENSMUSG00000023791
AA Change: D131G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
PIG-X	49	249	3.24e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000133584

SMART Domains

Protein: ENSMUSP00000119754
Gene: ENSMUSG00000023791

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135677

Predicted Effect

probably benign
Transcript: ENSMUST00000136643

SMART Domains

Protein: ENSMUSP00000118256
Gene: ENSMUSG00000023791

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143011

Predicted Effect

probably benign
Transcript: ENSMUST00000147003

SMART Domains

Protein: ENSMUSP00000120272
Gene: ENSMUSG00000023791

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
transmembrane domain	37	59	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147688

SMART Domains

Protein: ENSMUSP00000121801
Gene: ENSMUSG00000023791

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:PIG-X	49	105	1.6e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151250

Predicted Effect

probably damaging
Transcript: ENSMUST00000155966
AA Change: D129G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000114854
Gene: ENSMUSG00000023791
AA Change: D129G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
PIG-X	47	247	3.24e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000189013
AA Change: D129G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141122
Gene: ENSMUSG00000023791
AA Change: D129G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
PIG-X	47	247	3.24e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000215073
AA Change: D131G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000232321
AA Change: D27G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.6818

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a type I transmembrane protein in the endoplasmic reticulum (ER). The protein is an essential component of glycosylphosphatidylinositol-mannosyltransferase I, which transfers the first of the four mannoses in the GPI-anchor precursors during GPI-anchor biosynthesis. Studies in rat indicate that the protein is translated from a non-AUG translation initiation site. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530002B09Rik	A	T	4: 122,701,257	H102L	possibly damaging	Het
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Cdc42bpb	C	T	12: 111,296,391	G1501S	probably benign	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dcaf4	C	A	12: 83,537,701		probably null	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Dpyd	C	T	3: 118,897,126	Q295*	probably null	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Fcgr1	T	C	3: 96,284,276	*405W	probably null	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Golga4	A	G	9: 118,556,075	E727G	possibly damaging	Het
Hnrnpab	A	T	11: 51,602,624	N252K	probably benign	Het
Ing1	T	C	8: 11,561,934	V124A	probably damaging	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Lrp4	C	T	2: 91,488,518	S900L	possibly damaging	Het
Mbd5	A	G	2: 49,316,410	D1713G	probably damaging	Het
Muc6	T	G	7: 141,647,613	E808A	probably benign	Het
Mylk	G	T	16: 34,995,204		probably null	Het
Nbeal2	A	G	9: 110,637,937	V670A	possibly damaging	Het
Nphp3	T	C	9: 104,035,894		probably null	Het
Numbl	T	C	7: 27,279,602	S379P	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Pelp1	T	A	11: 70,398,150	T257S	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Plekhb1	T	C	7: 100,654,618	T112A	probably benign	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Ror1	A	G	4: 100,440,933	Q501R	probably damaging	Het
Sirpb1b	A	G	3: 15,503,183	V366A	probably benign	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Spata31	C	A	13: 64,921,648	P537T	probably benign	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Toe1	A	T	4: 116,806,111	N56K	probably damaging	Het
Tprkb	A	G	6: 85,928,782	K150E	probably damaging	Het
Trps1	T	C	15: 50,831,577	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Vps18	A	G	2: 119,297,228	Y844C	probably benign	Het
Wdr60	A	C	12: 116,211,840	S906A	possibly damaging	Het
Wdr72	T	A	9: 74,157,270	I528N	probably damaging	Het
Zfp292	C	T	4: 34,806,783	C2087Y	possibly damaging	Het
Zfp933	G	A	4: 147,826,470	A223V	probably damaging	Het
Zmynd8	G	A	2: 165,812,394	R724*	probably null	Het

Other mutations in Pigx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01998:Pigx	APN	16	32084610	missense	probably benign	0.43
IGL02662:Pigx	APN	16	32087383	missense	probably damaging	0.99
F5770:Pigx	UTSW	16	32087422	missense	probably damaging	1.00
R1682:Pigx	UTSW	16	32087450	missense	possibly damaging	0.91
R6195:Pigx	UTSW	16	32084586	missense	probably damaging	0.99
R6379:Pigx	UTSW	16	32084523	missense	probably damaging	1.00
R6521:Pigx	UTSW	16	32087311	missense	probably damaging	1.00
R9437:Pigx	UTSW	16	32099492	missense	probably benign	0.05
V7580:Pigx	UTSW	16	32087422	missense	probably damaging	1.00
Z1176:Pigx	UTSW	16	32087425	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCATTTGCCGTCCTTGACTAGACC -3'
(R):5'- GCGCCCTAGAAAGTTCTGACCTTTG -3'

Sequencing Primer
(F):5'- GTCCTTGACTAGACCCTCACAC -3'
(R):5'- CCCCACCCCGATTGATATTT -3'

Posted On

2014-01-29