Mutagenetix > Incidental Mutation

Incidental Mutation 'V7583:Mylk'

152676

Institutional Source

Beutler Lab

Gene Symbol

Mylk

Ensembl Gene

ENSMUSG00000022836

Gene Name

myosin, light polypeptide kinase

Synonyms

Mlck, nmMlck, telokin, A930019C19Rik, 9530072E15Rik, MLCK108, MLCK210

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

V7583 () of strain stinger

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34745210-35002420 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to T at 34995204 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000156149 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023538] [ENSMUST00000231589]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000023538

SMART Domains

Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836

Domain	Start	End	E-Value	Type
IGc2	54	122	9.05e-11	SMART
IGc2	177	244	3.94e-11	SMART
Pfam:23ISL	255	409	3.6e-60	PFAM
IGc2	423	491	1.55e-9	SMART
IGc2	523	587	3.32e-18	SMART
IGc2	632	699	6.02e-7	SMART
IGc2	730	798	1.36e-5	SMART
low complexity region	827	844	N/A	INTRINSIC
IGc2	1141	1208	2.42e-11	SMART
low complexity region	1251	1269	N/A	INTRINSIC
IG	1275	1359	4.56e-7	SMART
FN3	1362	1444	2.33e-11	SMART
low complexity region	1457	1479	N/A	INTRINSIC
S_TKc	1495	1750	4.23e-95	SMART
IGc2	1852	1920	5.92e-15	SMART
low complexity region	1934	1950	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000231589

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232477

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232548

Meta Mutation Damage Score

0.9494

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530002B09Rik	A	T	4: 122,701,257	H102L	possibly damaging	Het
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Cdc42bpb	C	T	12: 111,296,391	G1501S	probably benign	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dcaf4	C	A	12: 83,537,701		probably null	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Dpyd	C	T	3: 118,897,126	Q295*	probably null	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Fcgr1	T	C	3: 96,284,276	*405W	probably null	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Golga4	A	G	9: 118,556,075	E727G	possibly damaging	Het
Hnrnpab	A	T	11: 51,602,624	N252K	probably benign	Het
Ing1	T	C	8: 11,561,934	V124A	probably damaging	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Lrp4	C	T	2: 91,488,518	S900L	possibly damaging	Het
Mbd5	A	G	2: 49,316,410	D1713G	probably damaging	Het
Muc6	T	G	7: 141,647,613	E808A	probably benign	Het
Nbeal2	A	G	9: 110,637,937	V670A	possibly damaging	Het
Nphp3	T	C	9: 104,035,894		probably null	Het
Numbl	T	C	7: 27,279,602	S379P	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Pelp1	T	A	11: 70,398,150	T257S	probably damaging	Het
Pigx	T	C	16: 32,087,422	D129G	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Plekhb1	T	C	7: 100,654,618	T112A	probably benign	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Ror1	A	G	4: 100,440,933	Q501R	probably damaging	Het
Sirpb1b	A	G	3: 15,503,183	V366A	probably benign	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Spata31	C	A	13: 64,921,648	P537T	probably benign	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Toe1	A	T	4: 116,806,111	N56K	probably damaging	Het
Tprkb	A	G	6: 85,928,782	K150E	probably damaging	Het
Trps1	T	C	15: 50,831,577	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Vps18	A	G	2: 119,297,228	Y844C	probably benign	Het
Wdr60	A	C	12: 116,211,840	S906A	possibly damaging	Het
Wdr72	T	A	9: 74,157,270	I528N	probably damaging	Het
Zfp292	C	T	4: 34,806,783	C2087Y	possibly damaging	Het
Zfp933	G	A	4: 147,826,470	A223V	probably damaging	Het
Zmynd8	G	A	2: 165,812,394	R724*	probably null	Het

Other mutations in Mylk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01384:Mylk	APN	16	34938952	missense	probably benign	0.36
IGL01386:Mylk	APN	16	34971240	critical splice acceptor site	probably null
IGL01684:Mylk	APN	16	34971940	missense	possibly damaging	0.55
IGL01884:Mylk	APN	16	34988877	splice site	probably benign
IGL02079:Mylk	APN	16	34860631	missense	possibly damaging	0.87
IGL02104:Mylk	APN	16	34815435	missense	probably benign	0.06
IGL02624:Mylk	APN	16	34929896	missense	probably benign	0.29
IGL02756:Mylk	APN	16	34963646	missense	probably benign	0.42
IGL02794:Mylk	APN	16	34986541	missense	probably benign	0.21
IGL02833:Mylk	APN	16	34914900	missense	probably benign	0.01
IGL02946:Mylk	APN	16	34921788	missense	probably benign	0.10
IGL03012:Mylk	APN	16	34952781	missense	probably benign	0.03
IGL03093:Mylk	APN	16	34912192	missense	possibly damaging	0.62
IGL03272:Mylk	APN	16	34979189	missense	probably benign	0.09
billy	UTSW	16	34875620	missense	probably damaging	0.97
brutus	UTSW	16	34953695	missense	probably benign	0.12
Club	UTSW	16	34912275	nonsense	probably null
popeye	UTSW	16	34963577	missense	probably benign	0.29
F5770:Mylk	UTSW	16	34995204	critical splice donor site	probably null
P4717OSA:Mylk	UTSW	16	34977113	splice site	probably benign
PIT4382001:Mylk	UTSW	16	34875642	missense	probably damaging	0.99
R0131:Mylk	UTSW	16	34875504	missense	probably benign	0.03
R0309:Mylk	UTSW	16	34912297	splice site	probably benign
R0358:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0381:Mylk	UTSW	16	34784974	splice site	probably null
R0390:Mylk	UTSW	16	34875620	missense	probably damaging	0.97
R0413:Mylk	UTSW	16	34921944	missense	probably benign	0.01
R0536:Mylk	UTSW	16	35000387	missense	possibly damaging	0.95
R0544:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0545:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0546:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0547:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0548:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0627:Mylk	UTSW	16	35000429	missense	probably damaging	1.00
R0726:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0755:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0782:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0783:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R0784:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R1136:Mylk	UTSW	16	35000318	missense	probably damaging	1.00
R1170:Mylk	UTSW	16	34874039	missense	probably benign	0.20
R1222:Mylk	UTSW	16	34860652	missense	probably benign	0.12
R1445:Mylk	UTSW	16	34815465	missense	possibly damaging	0.57
R1583:Mylk	UTSW	16	34875586	missense	probably benign	0.29
R1618:Mylk	UTSW	16	34879475	missense	possibly damaging	0.74
R1643:Mylk	UTSW	16	34875635	missense	probably benign	0.03
R1702:Mylk	UTSW	16	34921944	missense	probably benign	0.00
R1776:Mylk	UTSW	16	34952782	missense	probably benign	0.16
R1865:Mylk	UTSW	16	34912230	missense	probably benign	0.03
R1975:Mylk	UTSW	16	34880303	splice site	probably null
R2016:Mylk	UTSW	16	34996817	missense	probably damaging	1.00
R2045:Mylk	UTSW	16	34953653	missense	probably benign	0.29
R2134:Mylk	UTSW	16	34986476	missense	probably benign	0.13
R3547:Mylk	UTSW	16	34880168	missense	possibly damaging	0.61
R3844:Mylk	UTSW	16	34921877	missense	probably benign	0.01
R4003:Mylk	UTSW	16	34963577	missense	probably benign	0.29
R4396:Mylk	UTSW	16	34912275	nonsense	probably null
R4470:Mylk	UTSW	16	34912152	missense	probably benign	0.09
R4507:Mylk	UTSW	16	34953695	missense	probably benign	0.12
R4700:Mylk	UTSW	16	34922435	missense	probably benign	0.16
R4751:Mylk	UTSW	16	34879169	missense	probably benign	0.29
R4815:Mylk	UTSW	16	34894925	missense	probably damaging	0.97
R4832:Mylk	UTSW	16	34922367	missense	probably benign	0.36
R4872:Mylk	UTSW	16	34914990	missense	possibly damaging	0.89
R4953:Mylk	UTSW	16	34988961	missense	probably damaging	1.00
R4969:Mylk	UTSW	16	34971440	missense	probably damaging	0.96
R5009:Mylk	UTSW	16	34899507	missense	probably benign	0.39
R5130:Mylk	UTSW	16	34988997	missense	probably damaging	1.00
R5173:Mylk	UTSW	16	34977013	missense	probably benign	0.40
R5195:Mylk	UTSW	16	34979215	missense	probably damaging	1.00
R5209:Mylk	UTSW	16	34922625	missense	possibly damaging	0.55
R5311:Mylk	UTSW	16	34921757	missense	probably benign	0.01
R5418:Mylk	UTSW	16	34912230	missense	probably benign	0.02
R5481:Mylk	UTSW	16	34921604	missense	probably benign	0.09
R5590:Mylk	UTSW	16	34879352	missense	probably benign	0.29
R5603:Mylk	UTSW	16	34956492	missense	probably benign	0.06
R5823:Mylk	UTSW	16	34894947	critical splice donor site	probably null
R6290:Mylk	UTSW	16	34894843	missense	probably benign	0.39
R6351:Mylk	UTSW	16	34921971	missense	probably benign	0.01
R6365:Mylk	UTSW	16	34860591	missense	probably benign	0.12
R6490:Mylk	UTSW	16	34929867	missense	possibly damaging	0.74
R6723:Mylk	UTSW	16	34929888	missense	possibly damaging	0.74
R6864:Mylk	UTSW	16	34874150	missense	probably benign	0.03
R6908:Mylk	UTSW	16	34880273	missense	probably benign	0.18
R6949:Mylk	UTSW	16	35000318	missense	probably damaging	1.00
R7018:Mylk	UTSW	16	35000426	missense	possibly damaging	0.88
R7035:Mylk	UTSW	16	34976982	missense	possibly damaging	0.89
R7162:Mylk	UTSW	16	34922529	missense	probably damaging	1.00
R7236:Mylk	UTSW	16	34922529	missense	probably damaging	1.00
R7269:Mylk	UTSW	16	34785011	missense	probably damaging	0.96
R7475:Mylk	UTSW	16	34914076	splice site	probably null
R7525:Mylk	UTSW	16	34988987	missense	probably benign	0.06
R7587:Mylk	UTSW	16	34922517	missense	probably benign	0.29
R7607:Mylk	UTSW	16	34894814	missense	probably benign	0.09
R7616:Mylk	UTSW	16	34879557	missense	probably damaging	0.97
R7647:Mylk	UTSW	16	34879524	missense	probably benign	0.29
R7648:Mylk	UTSW	16	34879524	missense	probably benign	0.29
R7764:Mylk	UTSW	16	34922183	missense	probably benign	0.16
R7890:Mylk	UTSW	16	34963648	nonsense	probably null
R7892:Mylk	UTSW	16	34879524	missense	probably benign	0.29
R7893:Mylk	UTSW	16	34879524	missense	probably benign	0.29
R8065:Mylk	UTSW	16	34972019	missense	probably benign	0.08
R8067:Mylk	UTSW	16	34972019	missense	probably benign	0.08
R8143:Mylk	UTSW	16	34914155	missense	possibly damaging	0.87
R8210:Mylk	UTSW	16	35000351	missense	probably damaging	1.00
R8271:Mylk	UTSW	16	34922579	missense	probably damaging	0.97
R8540:Mylk	UTSW	16	34929887	missense	possibly damaging	0.87
R8721:Mylk	UTSW	16	34996806	missense	probably damaging	1.00
R8743:Mylk	UTSW	16	34921057	missense	probably benign	0.03
R8798:Mylk	UTSW	16	34899402	missense	possibly damaging	0.89
R8956:Mylk	UTSW	16	34971409	missense	probably benign	0.01
R9131:Mylk	UTSW	16	34956465	missense	probably benign	0.29
R9403:Mylk	UTSW	16	34875642	nonsense	probably null
R9624:Mylk	UTSW	16	34879307	missense	probably benign	0.29
R9735:Mylk	UTSW	16	34914809	missense	probably benign	0.09
R9756:Mylk	UTSW	16	34914017	missense	probably damaging	0.96
R9763:Mylk	UTSW	16	34879112	nonsense	probably null
RF001:Mylk	UTSW	16	34879371	missense	probably benign	0.03
V7580:Mylk	UTSW	16	34995204	critical splice donor site	probably null
X0065:Mylk	UTSW	16	35000441	missense	probably damaging	1.00
Z1177:Mylk	UTSW	16	34922651	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- TGCAAACTGGAACCAGGGACAC -3'
(R):5'- TGTCCAGGCCACACAGATTTCAC -3'

Sequencing Primer
(F):5'- CCGCCTGAGTCCAACCTC -3'
(R):5'- TGGAATCTGCCCTGTACAAG -3'

Posted On

2014-01-29