Incidental Mutation 'R1081:Zfp770'
ID152680
Institutional Source Beutler Lab
Gene Symbol Zfp770
Ensembl Gene ENSMUSG00000040321
Gene Namezinc finger protein 770
Synonyms6430601A21Rik
MMRRC Submission 039167-MU
Accession Numbers

Ncbi RefSeq: NM_175466.4; MGI: 2445100

Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R1081 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location114193461-114201469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114197127 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 154 (Y154H)
Ref Sequence ENSEMBL: ENSMUSP00000052194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050668]
Predicted Effect probably damaging
Transcript: ENSMUST00000050668
AA Change: Y154H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052194
Gene: ENSMUSG00000040321
AA Change: Y154H

DomainStartEndE-ValueType
ZnF_C2H2 31 53 1.18e-2 SMART
ZnF_C2H2 59 81 4.11e-2 SMART
ZnF_C2H2 85 107 3.58e-2 SMART
ZnF_C2H2 164 186 2.09e-3 SMART
ZnF_C2H2 192 214 3.58e-2 SMART
ZnF_C2H2 220 242 3.29e-1 SMART
ZnF_C2H2 298 318 1.93e2 SMART
low complexity region 341 354 N/A INTRINSIC
ZnF_C2H2 485 507 5.9e-3 SMART
ZnF_C2H2 513 535 1.82e-3 SMART
low complexity region 576 595 N/A INTRINSIC
ZnF_C2H2 640 662 9.58e-3 SMART
ZnF_C2H2 668 690 7.37e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123562
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,020 E309G probably benign Het
Abr T C 11: 76,455,615 K448E probably damaging Het
Atxn2l T C 7: 126,494,212 Y785C probably damaging Het
Atxn3 T G 12: 101,934,349 D225A probably damaging Het
BC049730 T C 7: 24,713,542 probably null Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cntnap5c A G 17: 58,305,525 D853G possibly damaging Het
Dnah9 A G 11: 66,084,877 Y1449H probably damaging Het
Dsc2 T G 18: 20,033,295 T760P probably damaging Het
Dync2h1 A T 9: 7,005,488 probably null Het
Epg5 T C 18: 77,959,533 F611L possibly damaging Het
Fat3 T C 9: 16,375,284 D981G possibly damaging Het
Gimap3 A T 6: 48,765,152 C281* probably null Het
Ids T C X: 70,361,110 D149G possibly damaging Het
Inpp4b A G 8: 82,069,024 I826V probably damaging Het
Kcnrg C A 14: 61,607,714 H68N possibly damaging Het
Klra6 A G 6: 130,022,625 Y127H probably damaging Het
Mepce A G 5: 137,784,696 L456P probably damaging Het
Mink1 T C 11: 70,607,035 L488P probably benign Het
Mndal T A 1: 173,860,222 E482V probably benign Het
Mob1b G A 5: 88,753,162 V143I probably benign Het
Msh4 T C 3: 153,872,358 E433G probably benign Het
Myof A T 19: 37,986,088 I201N probably damaging Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ntsr1 G A 2: 180,538,756 S285N probably benign Het
Olfr319 C T 11: 58,702,498 H266Y probably damaging Het
Olfr598 A G 7: 103,329,038 Y184C probably damaging Het
Olfr66 T A 7: 103,882,177 H22L possibly damaging Het
Olfr730 A G 14: 50,187,197 S7P probably damaging Het
P2rx4 A G 5: 122,727,233 E307G probably damaging Het
Pcdh15 A G 10: 74,450,313 D793G probably damaging Het
Rpap1 G A 2: 119,771,269 R737W probably damaging Het
Rpusd4 A G 9: 35,275,088 K307E probably benign Het
Shtn1 T A 19: 58,975,015 T623S probably benign Het
Sntg1 A G 1: 8,445,119 C397R possibly damaging Het
Stat5a T C 11: 100,881,060 F646S probably damaging Het
Tacc2 A G 7: 130,728,574 E196G possibly damaging Het
Tcf25 T C 8: 123,381,473 V89A probably benign Het
Trim7 G T 11: 48,849,705 V210L probably damaging Het
Vmn2r57 A G 7: 41,428,211 M177T possibly damaging Het
Wwc2 G A 8: 47,828,764 probably benign Het
Zfp28 A G 7: 6,389,780 I152V possibly damaging Het
Zfp628 A G 7: 4,920,183 H468R probably damaging Het
Other mutations in Zfp770
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Zfp770 APN 2 114195932 missense probably benign 0.20
IGL00478:Zfp770 APN 2 114197465 missense probably damaging 1.00
IGL01539:Zfp770 APN 2 114197093 missense probably damaging 0.99
IGL01778:Zfp770 APN 2 114196238 missense probably damaging 0.96
IGL02596:Zfp770 APN 2 114195827 missense probably benign 0.11
IGL03227:Zfp770 APN 2 114197089 nonsense probably null
R0057:Zfp770 UTSW 2 114197232 nonsense probably null
R0057:Zfp770 UTSW 2 114197232 nonsense probably null
R1446:Zfp770 UTSW 2 114197033 missense probably damaging 0.99
R4477:Zfp770 UTSW 2 114196884 missense probably damaging 1.00
R4597:Zfp770 UTSW 2 114196770 missense possibly damaging 0.46
R4964:Zfp770 UTSW 2 114197387 missense probably benign 0.24
R4966:Zfp770 UTSW 2 114197387 missense probably benign 0.24
R5259:Zfp770 UTSW 2 114197193 missense probably benign 0.00
R5440:Zfp770 UTSW 2 114196115 missense probably benign 0.42
R5910:Zfp770 UTSW 2 114196232 nonsense probably null
R5941:Zfp770 UTSW 2 114197546 missense possibly damaging 0.83
R6074:Zfp770 UTSW 2 114196389 missense possibly damaging 0.68
R6341:Zfp770 UTSW 2 114196759 missense probably benign 0.14
R7181:Zfp770 UTSW 2 114197391 missense probably damaging 1.00
R7288:Zfp770 UTSW 2 114195661 nonsense probably null
R7935:Zfp770 UTSW 2 114196824 missense probably benign 0.00
R8119:Zfp770 UTSW 2 114197027 missense probably damaging 1.00
R8304:Zfp770 UTSW 2 114197410 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGGAAGACACTTGTGTCCATTG -3'
(R):5'- CAACTCGTTCATCTGGAGAGGCATC -3'

Sequencing Primer
(F):5'- AAAAGCATCCTGCTTTGCG -3'
(R):5'- CAGTTGTAATATTTGCCAACGCC -3'
Posted On2014-01-29