Incidental Mutation 'R1081:Rpap1'
ID152681
Institutional Source Beutler Lab
Gene Symbol Rpap1
Ensembl Gene ENSMUSG00000034032
Gene NameRNA polymerase II associated protein 1
Synonyms
MMRRC Submission 039167-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R1081 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119763304-119787537 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119771269 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 737 (R737W)
Ref Sequence ENSEMBL: ENSMUSP00000138873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048493] [ENSMUST00000099529] [ENSMUST00000110793] [ENSMUST00000136419] [ENSMUST00000184294]
Predicted Effect probably damaging
Transcript: ENSMUST00000048493
AA Change: R737W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037275
Gene: ENSMUSG00000034032
AA Change: R737W

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 225 270 2.4e-21 PFAM
Pfam:RPAP1_C 372 438 1.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099529
AA Change: R737W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097127
Gene: ENSMUSG00000034032
AA Change: R737W

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 1.7e-21 PFAM
Pfam:RPAP1_C 370 440 2.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110793
AA Change: R737W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106420
Gene: ENSMUSG00000034032
AA Change: R737W

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 1.7e-21 PFAM
Pfam:RPAP1_C 370 440 2.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136419
SMART Domains Protein: ENSMUSP00000138619
Gene: ENSMUSG00000034032

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139311
Predicted Effect probably damaging
Transcript: ENSMUST00000184294
AA Change: R737W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138873
Gene: ENSMUSG00000034032
AA Change: R737W

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 4.8e-22 PFAM
Pfam:RPAP1_C 370 440 1.2e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein forms part of the RNA polymerase II (RNAPII) enzyme complex and may recruit RNAPII to chromatin through its interaction with acetylated histones. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,020 E309G probably benign Het
Abr T C 11: 76,455,615 K448E probably damaging Het
Atxn2l T C 7: 126,494,212 Y785C probably damaging Het
Atxn3 T G 12: 101,934,349 D225A probably damaging Het
BC049730 T C 7: 24,713,542 probably null Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cntnap5c A G 17: 58,305,525 D853G possibly damaging Het
Dnah9 A G 11: 66,084,877 Y1449H probably damaging Het
Dsc2 T G 18: 20,033,295 T760P probably damaging Het
Dync2h1 A T 9: 7,005,488 probably null Het
Epg5 T C 18: 77,959,533 F611L possibly damaging Het
Fat3 T C 9: 16,375,284 D981G possibly damaging Het
Gimap3 A T 6: 48,765,152 C281* probably null Het
Ids T C X: 70,361,110 D149G possibly damaging Het
Inpp4b A G 8: 82,069,024 I826V probably damaging Het
Kcnrg C A 14: 61,607,714 H68N possibly damaging Het
Klra6 A G 6: 130,022,625 Y127H probably damaging Het
Mepce A G 5: 137,784,696 L456P probably damaging Het
Mink1 T C 11: 70,607,035 L488P probably benign Het
Mndal T A 1: 173,860,222 E482V probably benign Het
Mob1b G A 5: 88,753,162 V143I probably benign Het
Msh4 T C 3: 153,872,358 E433G probably benign Het
Myof A T 19: 37,986,088 I201N probably damaging Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ntsr1 G A 2: 180,538,756 S285N probably benign Het
Olfr319 C T 11: 58,702,498 H266Y probably damaging Het
Olfr598 A G 7: 103,329,038 Y184C probably damaging Het
Olfr66 T A 7: 103,882,177 H22L possibly damaging Het
Olfr730 A G 14: 50,187,197 S7P probably damaging Het
P2rx4 A G 5: 122,727,233 E307G probably damaging Het
Pcdh15 A G 10: 74,450,313 D793G probably damaging Het
Rpusd4 A G 9: 35,275,088 K307E probably benign Het
Shtn1 T A 19: 58,975,015 T623S probably benign Het
Sntg1 A G 1: 8,445,119 C397R possibly damaging Het
Stat5a T C 11: 100,881,060 F646S probably damaging Het
Tacc2 A G 7: 130,728,574 E196G possibly damaging Het
Tcf25 T C 8: 123,381,473 V89A probably benign Het
Trim7 G T 11: 48,849,705 V210L probably damaging Het
Vmn2r57 A G 7: 41,428,211 M177T possibly damaging Het
Wwc2 G A 8: 47,828,764 probably benign Het
Zfp28 A G 7: 6,389,780 I152V possibly damaging Het
Zfp628 A G 7: 4,920,183 H468R probably damaging Het
Zfp770 A G 2: 114,197,127 Y154H probably damaging Het
Other mutations in Rpap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01807:Rpap1 APN 2 119782708 missense possibly damaging 0.50
IGL02009:Rpap1 APN 2 119780113 missense possibly damaging 0.51
IGL02068:Rpap1 APN 2 119782654 missense probably benign 0.02
IGL02100:Rpap1 APN 2 119769326 missense probably benign 0.06
IGL02528:Rpap1 APN 2 119774950 splice site probably null
IGL02530:Rpap1 APN 2 119783239 splice site probably benign
IGL02747:Rpap1 APN 2 119774128 missense probably damaging 0.98
IGL03371:Rpap1 APN 2 119775057 splice site probably benign
R0138:Rpap1 UTSW 2 119764899 splice site probably null
R0325:Rpap1 UTSW 2 119771840 missense probably benign
R0616:Rpap1 UTSW 2 119778120 missense probably damaging 1.00
R1657:Rpap1 UTSW 2 119783778 missense possibly damaging 0.53
R1837:Rpap1 UTSW 2 119769885 critical splice donor site probably null
R2307:Rpap1 UTSW 2 119783766 missense probably benign 0.00
R2308:Rpap1 UTSW 2 119783766 missense probably benign 0.00
R2375:Rpap1 UTSW 2 119770407 missense possibly damaging 0.50
R2507:Rpap1 UTSW 2 119780054 critical splice donor site probably null
R2508:Rpap1 UTSW 2 119780054 critical splice donor site probably null
R4155:Rpap1 UTSW 2 119774179 missense probably damaging 1.00
R4156:Rpap1 UTSW 2 119774179 missense probably damaging 1.00
R4157:Rpap1 UTSW 2 119774179 missense probably damaging 1.00
R4657:Rpap1 UTSW 2 119775006 missense probably benign 0.03
R4837:Rpap1 UTSW 2 119778251 missense probably benign 0.32
R4880:Rpap1 UTSW 2 119783865 missense probably damaging 0.97
R5010:Rpap1 UTSW 2 119770041 missense probably benign
R5111:Rpap1 UTSW 2 119771247 missense probably damaging 1.00
R5650:Rpap1 UTSW 2 119773850 missense probably benign
R6144:Rpap1 UTSW 2 119772647 nonsense probably null
R6353:Rpap1 UTSW 2 119776896 splice site probably null
R6646:Rpap1 UTSW 2 119780131 missense probably benign 0.03
R6731:Rpap1 UTSW 2 119778296 missense probably benign
R6872:Rpap1 UTSW 2 119775369 missense probably damaging 1.00
R6878:Rpap1 UTSW 2 119778176 missense probably damaging 1.00
R7060:Rpap1 UTSW 2 119773562 missense probably damaging 1.00
R7558:Rpap1 UTSW 2 119771254 missense probably benign
R7640:Rpap1 UTSW 2 119764410 missense possibly damaging 0.63
R7862:Rpap1 UTSW 2 119775412 critical splice acceptor site probably null
R8055:Rpap1 UTSW 2 119764803 missense probably benign 0.13
X0028:Rpap1 UTSW 2 119771062 missense probably benign
Z1177:Rpap1 UTSW 2 119783752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGACATGGCTCCACCAGTGGC -3'
(R):5'- AGCTCCTGGCAGAATTGTGCTCTC -3'

Sequencing Primer
(F):5'- CTTGAGTCCAGACACCTGTG -3'
(R):5'- GCAGAATTGTGCTCTCCTCTTG -3'
Posted On2014-01-29