Incidental Mutation 'R1081:Ntsr1'
ID152682
Institutional Source Beutler Lab
Gene Symbol Ntsr1
Ensembl Gene ENSMUSG00000027568
Gene Nameneurotensin receptor 1
SynonymsNtsr1, NTR1, NTR-1, NT-1R
MMRRC Submission 039167-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1081 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location180499976-180544980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 180538756 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 285 (S285N)
Ref Sequence ENSEMBL: ENSMUSP00000127548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029084] [ENSMUST00000170448]
Predicted Effect probably benign
Transcript: ENSMUST00000029084
AA Change: S285N

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029084
Gene: ENSMUSG00000027568
AA Change: S285N

DomainStartEndE-ValueType
low complexity region 31 49 N/A INTRINSIC
Pfam:7tm_1 80 369 7.5e-55 PFAM
Pfam:7TM_GPCR_Srv 82 386 1e-8 PFAM
low complexity region 392 398 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170448
AA Change: S285N

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127548
Gene: ENSMUSG00000027568
AA Change: S285N

DomainStartEndE-ValueType
low complexity region 31 49 N/A INTRINSIC
Pfam:7tm_4 70 283 6.7e-9 PFAM
Pfam:7tm_1 80 369 2e-51 PFAM
Pfam:7TM_GPCR_Srv 83 386 1.8e-8 PFAM
low complexity region 392 398 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotensin receptor 1 belongs to the large superfamily of G-protein coupled receptors. NTSR1 mediates the multiple functions of neurotensin, such as hypotension, hyperglycemia, hypothermia, antinociception, and regulation of intestinal motility and secretion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice deficient for this marker have normal baseline prepulse inhibition responses and acoustic startle responses. Mice are heavier, eat more, and have lower body temperatures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,020 E309G probably benign Het
Abr T C 11: 76,455,615 K448E probably damaging Het
Atxn2l T C 7: 126,494,212 Y785C probably damaging Het
Atxn3 T G 12: 101,934,349 D225A probably damaging Het
BC049730 T C 7: 24,713,542 probably null Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cntnap5c A G 17: 58,305,525 D853G possibly damaging Het
Dnah9 A G 11: 66,084,877 Y1449H probably damaging Het
Dsc2 T G 18: 20,033,295 T760P probably damaging Het
Dync2h1 A T 9: 7,005,488 probably null Het
Epg5 T C 18: 77,959,533 F611L possibly damaging Het
Fat3 T C 9: 16,375,284 D981G possibly damaging Het
Gimap3 A T 6: 48,765,152 C281* probably null Het
Ids T C X: 70,361,110 D149G possibly damaging Het
Inpp4b A G 8: 82,069,024 I826V probably damaging Het
Kcnrg C A 14: 61,607,714 H68N possibly damaging Het
Klra6 A G 6: 130,022,625 Y127H probably damaging Het
Mepce A G 5: 137,784,696 L456P probably damaging Het
Mink1 T C 11: 70,607,035 L488P probably benign Het
Mndal T A 1: 173,860,222 E482V probably benign Het
Mob1b G A 5: 88,753,162 V143I probably benign Het
Msh4 T C 3: 153,872,358 E433G probably benign Het
Myof A T 19: 37,986,088 I201N probably damaging Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Olfr319 C T 11: 58,702,498 H266Y probably damaging Het
Olfr598 A G 7: 103,329,038 Y184C probably damaging Het
Olfr66 T A 7: 103,882,177 H22L possibly damaging Het
Olfr730 A G 14: 50,187,197 S7P probably damaging Het
P2rx4 A G 5: 122,727,233 E307G probably damaging Het
Pcdh15 A G 10: 74,450,313 D793G probably damaging Het
Rpap1 G A 2: 119,771,269 R737W probably damaging Het
Rpusd4 A G 9: 35,275,088 K307E probably benign Het
Shtn1 T A 19: 58,975,015 T623S probably benign Het
Sntg1 A G 1: 8,445,119 C397R possibly damaging Het
Stat5a T C 11: 100,881,060 F646S probably damaging Het
Tacc2 A G 7: 130,728,574 E196G possibly damaging Het
Tcf25 T C 8: 123,381,473 V89A probably benign Het
Trim7 G T 11: 48,849,705 V210L probably damaging Het
Vmn2r57 A G 7: 41,428,211 M177T possibly damaging Het
Wwc2 G A 8: 47,828,764 probably benign Het
Zfp28 A G 7: 6,389,780 I152V possibly damaging Het
Zfp628 A G 7: 4,920,183 H468R probably damaging Het
Zfp770 A G 2: 114,197,127 Y154H probably damaging Het
Other mutations in Ntsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Ntsr1 APN 2 180542542 missense probably damaging 0.99
IGL01765:Ntsr1 APN 2 180538717 missense possibly damaging 0.56
IGL02137:Ntsr1 APN 2 180538835 critical splice donor site probably null
IGL02321:Ntsr1 APN 2 180538834 critical splice donor site probably null
IGL03349:Ntsr1 APN 2 180500502 missense probably benign
R0482:Ntsr1 UTSW 2 180501056 missense possibly damaging 0.54
R0542:Ntsr1 UTSW 2 180542581 missense probably damaging 1.00
R1241:Ntsr1 UTSW 2 180500601 missense probably damaging 1.00
R1540:Ntsr1 UTSW 2 180542647 missense probably damaging 0.99
R3718:Ntsr1 UTSW 2 180542706 missense probably benign 0.00
R4206:Ntsr1 UTSW 2 180500752 missense probably damaging 1.00
R5481:Ntsr1 UTSW 2 180541520 missense possibly damaging 0.79
R5703:Ntsr1 UTSW 2 180500433 missense probably damaging 0.98
R5975:Ntsr1 UTSW 2 180500788 missense probably damaging 1.00
R6643:Ntsr1 UTSW 2 180500926 missense probably damaging 1.00
R6754:Ntsr1 UTSW 2 180542683 missense probably benign 0.00
R7295:Ntsr1 UTSW 2 180500932 missense probably damaging 1.00
R7316:Ntsr1 UTSW 2 180500752 missense probably damaging 1.00
R7765:Ntsr1 UTSW 2 180538817 missense probably damaging 0.99
R7822:Ntsr1 UTSW 2 180538690 missense probably damaging 1.00
R8087:Ntsr1 UTSW 2 180500172 unclassified probably benign
R8555:Ntsr1 UTSW 2 180538677 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCTCTGAGCACAAAGGGTGATAGTC -3'
(R):5'- ACGATGCTGAACTTGGACCCAC -3'

Sequencing Primer
(F):5'- AAGGGTGATAGTCCCTCACCTG -3'
(R):5'- TGAACTTGGACCCACATTCC -3'
Posted On2014-01-29