Mutagenetix > Incidental Mutations

Incidental Mutation 'R1081:Msh4'

152684

Institutional Source

Beutler Lab

Gene Symbol

Msh4

Ensembl Gene

ENSMUSG00000005493

Gene Name

mutS homolog 4

Synonyms

mMsh4, 4930485C04Rik

MMRRC Submission

039167-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.383) question?

Stock #

R1081 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

153857149-153906138 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 153872358 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 433 (E433G)

Ref Sequence

ENSEMBL: ENSMUSP00000140265 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005630] [ENSMUST00000188338] [ENSMUST00000190449]

Predicted Effect

probably benign
Transcript: ENSMUST00000005630
AA Change: E627G

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000005630
Gene: ENSMUSG00000005493
AA Change: E627G

Domain	Start	End	E-Value	Type
low complexity region	91	107	N/A	INTRINSIC
Pfam:MutS_II	177	321	2.3e-20	PFAM
MUTSd	352	679	3.77e-37	SMART
MUTSac	695	888	1.6e-81	SMART
Blast:MUTSac	912	956	1e-9	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186220

Predicted Effect

probably benign
Transcript: ENSMUST00000188338
AA Change: E539G

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000140190
Gene: ENSMUSG00000005493
AA Change: E539G

Domain	Start	End	E-Value	Type
Pfam:MutS_II	89	233	5.3e-19	PFAM
MUTSd	264	591	9.4e-40	SMART
MUTSac	607	800	4.2e-84	SMART
Blast:MUTSac	808	866	4e-17	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000190449
AA Change: E433G

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000140265
Gene: ENSMUSG00000005493
AA Change: E433G

Domain	Start	End	E-Value	Type
Pfam:MutS_II	1	127	3.3e-15	PFAM
MUTSd	158	485	9.4e-40	SMART
MUTSac	501	694	4.2e-84	SMART
Blast:MUTSac	702	760	5e-17	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191504

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191606

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair mutS family. This member is a meiosis-specific protein that is not involved in DNA mismatch correction, but is required for reciprocal recombination and proper segregation of homologous chromosomes at meiosis I. This protein and MSH5 form a heterodimer which binds uniquely to a Holliday Junction and its developmental progenitor, thus provoking ADP-ATP exchange, and stabilizing the interaction between parental chromosomes during meiosis double-stranded break repair. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male and female sterility associated with failure to undergo pairing during meiosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	A	G	6: 83,162,020	E309G	probably benign	Het
Abr	T	C	11: 76,455,615	K448E	probably damaging	Het
Atxn2l	T	C	7: 126,494,212	Y785C	probably damaging	Het
Atxn3	T	G	12: 101,934,349	D225A	probably damaging	Het
BC049730	T	C	7: 24,713,542		probably null	Het
Cdh15	G	C	8: 122,857,495	E112Q	probably damaging	Het
Cntnap5c	A	G	17: 58,305,525	D853G	possibly damaging	Het
Dnah9	A	G	11: 66,084,877	Y1449H	probably damaging	Het
Dsc2	T	G	18: 20,033,295	T760P	probably damaging	Het
Dync2h1	A	T	9: 7,005,488		probably null	Het
Epg5	T	C	18: 77,959,533	F611L	possibly damaging	Het
Fat3	T	C	9: 16,375,284	D981G	possibly damaging	Het
Gimap3	A	T	6: 48,765,152	C281*	probably null	Het
Ids	T	C	X: 70,361,110	D149G	possibly damaging	Het
Inpp4b	A	G	8: 82,069,024	I826V	probably damaging	Het
Kcnrg	C	A	14: 61,607,714	H68N	possibly damaging	Het
Klra6	A	G	6: 130,022,625	Y127H	probably damaging	Het
Mepce	A	G	5: 137,784,696	L456P	probably damaging	Het
Mink1	T	C	11: 70,607,035	L488P	probably benign	Het
Mndal	T	A	1: 173,860,222	E482V	probably benign	Het
Mob1b	G	A	5: 88,753,162	V143I	probably benign	Het
Myof	A	T	19: 37,986,088	I201N	probably damaging	Het
Naip1	G	A	13: 100,423,070	S1142F	probably benign	Het
Ntsr1	G	A	2: 180,538,756	S285N	probably benign	Het
Olfr319	C	T	11: 58,702,498	H266Y	probably damaging	Het
Olfr598	A	G	7: 103,329,038	Y184C	probably damaging	Het
Olfr66	T	A	7: 103,882,177	H22L	possibly damaging	Het
Olfr730	A	G	14: 50,187,197	S7P	probably damaging	Het
P2rx4	A	G	5: 122,727,233	E307G	probably damaging	Het
Pcdh15	A	G	10: 74,450,313	D793G	probably damaging	Het
Rpap1	G	A	2: 119,771,269	R737W	probably damaging	Het
Rpusd4	A	G	9: 35,275,088	K307E	probably benign	Het
Shtn1	T	A	19: 58,975,015	T623S	probably benign	Het
Sntg1	A	G	1: 8,445,119	C397R	possibly damaging	Het
Stat5a	T	C	11: 100,881,060	F646S	probably damaging	Het
Tacc2	A	G	7: 130,728,574	E196G	possibly damaging	Het
Tcf25	T	C	8: 123,381,473	V89A	probably benign	Het
Trim7	G	T	11: 48,849,705	V210L	probably damaging	Het
Vmn2r57	A	G	7: 41,428,211	M177T	possibly damaging	Het
Wwc2	G	A	8: 47,828,764		probably benign	Het
Zfp28	A	G	7: 6,389,780	I152V	possibly damaging	Het
Zfp628	A	G	7: 4,920,183	H468R	probably damaging	Het
Zfp770	A	G	2: 114,197,127	Y154H	probably damaging	Het

Other mutations in Msh4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00862:Msh4	APN	3	153883735	missense	possibly damaging	0.88
IGL01098:Msh4	APN	3	153877982	splice site	probably benign
IGL01609:Msh4	APN	3	153897397	missense	probably damaging	1.00
IGL01785:Msh4	APN	3	153857507	missense	probably damaging	1.00
IGL01939:Msh4	APN	3	153857589	missense	probably damaging	1.00
IGL02022:Msh4	APN	3	153886956	missense	probably damaging	1.00
IGL02209:Msh4	APN	3	153888862	missense	probably damaging	1.00
IGL02224:Msh4	APN	3	153890185	missense	possibly damaging	0.94
IGL02240:Msh4	APN	3	153873674	missense	probably damaging	0.98
IGL02493:Msh4	APN	3	153877908	critical splice donor site	probably null
IGL02576:Msh4	APN	3	153867746	missense	probably damaging	1.00
IGL02616:Msh4	APN	3	153857523	missense	probably benign
IGL02812:Msh4	APN	3	153901400	splice site	probably benign
IGL02888:Msh4	APN	3	153896913	nonsense	probably null
IGL02992:Msh4	APN	3	153872325	missense	possibly damaging	0.79
IGL03191:Msh4	APN	3	153869608	missense	probably damaging	0.97
P0021:Msh4	UTSW	3	153888818	missense	probably damaging	1.00
R0057:Msh4	UTSW	3	153869681	missense	probably benign	0.16
R0057:Msh4	UTSW	3	153869681	missense	probably benign	0.16
R0368:Msh4	UTSW	3	153888825	missense	probably damaging	1.00
R0377:Msh4	UTSW	3	153896890	missense	probably benign	0.00
R0631:Msh4	UTSW	3	153866420	missense	probably benign	0.02
R0632:Msh4	UTSW	3	153896895	missense	probably damaging	1.00
R0677:Msh4	UTSW	3	153879367	missense	possibly damaging	0.69
R0909:Msh4	UTSW	3	153863504	missense	probably benign	0.00
R1463:Msh4	UTSW	3	153857570	missense	probably damaging	1.00
R1476:Msh4	UTSW	3	153863384	missense	probably damaging	1.00
R1669:Msh4	UTSW	3	153876720	missense	possibly damaging	0.47
R1733:Msh4	UTSW	3	153867767	missense	probably damaging	1.00
R1859:Msh4	UTSW	3	153905880	missense	probably benign
R2168:Msh4	UTSW	3	153867835	nonsense	probably null
R2378:Msh4	UTSW	3	153863477	missense	probably damaging	0.99
R2991:Msh4	UTSW	3	153905860	missense	probably benign
R3025:Msh4	UTSW	3	153863491	missense	probably damaging	1.00
R4604:Msh4	UTSW	3	153872283	missense	probably damaging	1.00
R4757:Msh4	UTSW	3	153879387	missense	probably damaging	0.99
R5205:Msh4	UTSW	3	153866412	missense	probably damaging	1.00
R5285:Msh4	UTSW	3	153873713	missense	probably benign	0.03
R5766:Msh4	UTSW	3	153867840	missense	probably damaging	1.00
R5777:Msh4	UTSW	3	153863439	missense	probably benign	0.01
R5888:Msh4	UTSW	3	153867723	critical splice donor site	probably null
R7384:Msh4	UTSW	3	153888748	missense	probably benign	0.23
R7408:Msh4	UTSW	3	153876745	missense	probably benign	0.06
R7487:Msh4	UTSW	3	153863510	missense	probably damaging	1.00
R7503:Msh4	UTSW	3	153867750	missense	probably damaging	1.00
R7726:Msh4	UTSW	3	153866320	critical splice donor site	probably null
R7990:Msh4	UTSW	3	153896892	missense	probably damaging	1.00
R8097:Msh4	UTSW	3	153877908	critical splice donor site	probably null
Z1177:Msh4	UTSW	3	153879368	missense	probably benign	0.00
Z1177:Msh4	UTSW	3	153901443	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- agaaccatctatccagcccGCTAAA -3'
(R):5'- tgtttttgtgggtgtgAGACAGATTGT -3'

Sequencing Primer
(F):5'- CTTAGTTTGGGTCACAGACAAG -3'
(R):5'- CCTGGTAGATGTGACAATAAACTG -3'

Posted On

2014-01-29