Incidental Mutation 'R1081:Mob1b'
ID152685
Institutional Source Beutler Lab
Gene Symbol Mob1b
Ensembl Gene ENSMUSG00000006262
Gene NameMOB kinase activator 1B
SynonymsMobkl1a, 1110003E08Rik
MMRRC Submission 039167-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R1081 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location88720855-88764220 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88753162 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 143 (V143I)
Ref Sequence ENSEMBL: ENSMUSP00000108855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006424] [ENSMUST00000113229]
Predicted Effect probably benign
Transcript: ENSMUST00000006424
AA Change: V138I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000006424
Gene: ENSMUSG00000006262
AA Change: V138I

DomainStartEndE-ValueType
Pfam:Mob1_phocein 29 205 1.2e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113229
AA Change: V143I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108855
Gene: ENSMUSG00000006262
AA Change: V143I

DomainStartEndE-ValueType
Mob1_phocein 31 209 2.18e-113 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155298
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to the yeast Mob1 protein. Yeast Mob1 binds Mps1p, a protein kinase essential for spindle pole body duplication and mitotic checkpoint regulation. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,020 E309G probably benign Het
Abr T C 11: 76,455,615 K448E probably damaging Het
Atxn2l T C 7: 126,494,212 Y785C probably damaging Het
Atxn3 T G 12: 101,934,349 D225A probably damaging Het
BC049730 T C 7: 24,713,542 probably null Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cntnap5c A G 17: 58,305,525 D853G possibly damaging Het
Dnah9 A G 11: 66,084,877 Y1449H probably damaging Het
Dsc2 T G 18: 20,033,295 T760P probably damaging Het
Dync2h1 A T 9: 7,005,488 probably null Het
Epg5 T C 18: 77,959,533 F611L possibly damaging Het
Fat3 T C 9: 16,375,284 D981G possibly damaging Het
Gimap3 A T 6: 48,765,152 C281* probably null Het
Ids T C X: 70,361,110 D149G possibly damaging Het
Inpp4b A G 8: 82,069,024 I826V probably damaging Het
Kcnrg C A 14: 61,607,714 H68N possibly damaging Het
Klra6 A G 6: 130,022,625 Y127H probably damaging Het
Mepce A G 5: 137,784,696 L456P probably damaging Het
Mink1 T C 11: 70,607,035 L488P probably benign Het
Mndal T A 1: 173,860,222 E482V probably benign Het
Msh4 T C 3: 153,872,358 E433G probably benign Het
Myof A T 19: 37,986,088 I201N probably damaging Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ntsr1 G A 2: 180,538,756 S285N probably benign Het
Olfr319 C T 11: 58,702,498 H266Y probably damaging Het
Olfr598 A G 7: 103,329,038 Y184C probably damaging Het
Olfr66 T A 7: 103,882,177 H22L possibly damaging Het
Olfr730 A G 14: 50,187,197 S7P probably damaging Het
P2rx4 A G 5: 122,727,233 E307G probably damaging Het
Pcdh15 A G 10: 74,450,313 D793G probably damaging Het
Rpap1 G A 2: 119,771,269 R737W probably damaging Het
Rpusd4 A G 9: 35,275,088 K307E probably benign Het
Shtn1 T A 19: 58,975,015 T623S probably benign Het
Sntg1 A G 1: 8,445,119 C397R possibly damaging Het
Stat5a T C 11: 100,881,060 F646S probably damaging Het
Tacc2 A G 7: 130,728,574 E196G possibly damaging Het
Tcf25 T C 8: 123,381,473 V89A probably benign Het
Trim7 G T 11: 48,849,705 V210L probably damaging Het
Vmn2r57 A G 7: 41,428,211 M177T possibly damaging Het
Wwc2 G A 8: 47,828,764 probably benign Het
Zfp28 A G 7: 6,389,780 I152V possibly damaging Het
Zfp628 A G 7: 4,920,183 H468R probably damaging Het
Zfp770 A G 2: 114,197,127 Y154H probably damaging Het
Other mutations in Mob1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Mob1b APN 5 88756155 missense probably benign 0.00
IGL01475:Mob1b APN 5 88749643 missense probably damaging 1.00
IGL02478:Mob1b APN 5 88756088 splice site probably benign
R0012:Mob1b UTSW 5 88756084 splice site probably benign
R0012:Mob1b UTSW 5 88756084 splice site probably benign
R0938:Mob1b UTSW 5 88749593 missense probably damaging 1.00
R3500:Mob1b UTSW 5 88749620 missense probably benign 0.00
R3890:Mob1b UTSW 5 88753202 missense probably damaging 0.97
R3891:Mob1b UTSW 5 88753202 missense probably damaging 0.97
R3892:Mob1b UTSW 5 88753202 missense probably damaging 0.97
R7243:Mob1b UTSW 5 88743445 missense probably damaging 0.96
R7302:Mob1b UTSW 5 88753177 missense probably benign
R7782:Mob1b UTSW 5 88749683 splice site probably null
R8101:Mob1b UTSW 5 88753234 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- tccccCAAGGGCAAATTTCATTTTAGt -3'
(R):5'- GCTTAATGAGTCAACCTACCTGAACGAA -3'

Sequencing Primer
(F):5'- cttgaactcagaaatccgcc -3'
(R):5'- TACCTGAACGAAAAAAATAAAGTGC -3'
Posted On2014-01-29