Incidental Mutation 'R1081:P2rx4'
ID152686
Institutional Source Beutler Lab
Gene Symbol P2rx4
Ensembl Gene ENSMUSG00000029470
Gene Namepurinergic receptor P2X, ligand-gated ion channel 4
SynonymsD5Ertd444e, P2X4
MMRRC Submission 039167-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1081 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location122707544-122729738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122727233 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 307 (E307G)
Ref Sequence ENSEMBL: ENSMUSP00000031429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031429] [ENSMUST00000081554] [ENSMUST00000111668] [ENSMUST00000139631] [ENSMUST00000142664] [ENSMUST00000198560]
Predicted Effect probably damaging
Transcript: ENSMUST00000031429
AA Change: E307G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031429
Gene: ENSMUSG00000029470
AA Change: E307G

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 381 3e-175 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000081554
AA Change: E280G

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080269
Gene: ENSMUSG00000029470
AA Change: E280G

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 176 1.6e-72 PFAM
Pfam:P2X_receptor 170 361 2.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111668
SMART Domains Protein: ENSMUSP00000107297
Gene: ENSMUSG00000029471

DomainStartEndE-ValueType
low complexity region 124 144 N/A INTRINSIC
S_TKc 165 446 1.53e-92 SMART
low complexity region 464 472 N/A INTRINSIC
low complexity region 526 539 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132062
Predicted Effect possibly damaging
Transcript: ENSMUST00000139631
AA Change: E280G

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118163
Gene: ENSMUSG00000029470
AA Change: E280G

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 176 3.7e-73 PFAM
Pfam:P2X_receptor 171 301 4.6e-59 PFAM
Pfam:P2X_receptor 299 331 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139712
Predicted Effect possibly damaging
Transcript: ENSMUST00000142664
AA Change: E307G

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117193
Gene: ENSMUSG00000029470
AA Change: E307G

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 358 2.7e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198560
SMART Domains Protein: ENSMUSP00000142849
Gene: ENSMUSG00000029470

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 47 6.9e-9 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel with high calcium permeability. The main pharmacological distinction between the members of the purinoceptor family is the relative sensitivity to the antagonists suramin and PPADS. The product of this gene has the lowest sensitivity for these antagonists. Multiple alternatively spliced transcript variants, some protein-coding and some not protein-coding, have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in hypertension, abnormal artery morphology, abnormal nitric oxide homeostasis, and impaired flow induced vascular remodeling and vasodilation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,020 E309G probably benign Het
Abr T C 11: 76,455,615 K448E probably damaging Het
Atxn2l T C 7: 126,494,212 Y785C probably damaging Het
Atxn3 T G 12: 101,934,349 D225A probably damaging Het
BC049730 T C 7: 24,713,542 probably null Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cntnap5c A G 17: 58,305,525 D853G possibly damaging Het
Dnah9 A G 11: 66,084,877 Y1449H probably damaging Het
Dsc2 T G 18: 20,033,295 T760P probably damaging Het
Dync2h1 A T 9: 7,005,488 probably null Het
Epg5 T C 18: 77,959,533 F611L possibly damaging Het
Fat3 T C 9: 16,375,284 D981G possibly damaging Het
Gimap3 A T 6: 48,765,152 C281* probably null Het
Ids T C X: 70,361,110 D149G possibly damaging Het
Inpp4b A G 8: 82,069,024 I826V probably damaging Het
Kcnrg C A 14: 61,607,714 H68N possibly damaging Het
Klra6 A G 6: 130,022,625 Y127H probably damaging Het
Mepce A G 5: 137,784,696 L456P probably damaging Het
Mink1 T C 11: 70,607,035 L488P probably benign Het
Mndal T A 1: 173,860,222 E482V probably benign Het
Mob1b G A 5: 88,753,162 V143I probably benign Het
Msh4 T C 3: 153,872,358 E433G probably benign Het
Myof A T 19: 37,986,088 I201N probably damaging Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ntsr1 G A 2: 180,538,756 S285N probably benign Het
Olfr319 C T 11: 58,702,498 H266Y probably damaging Het
Olfr598 A G 7: 103,329,038 Y184C probably damaging Het
Olfr66 T A 7: 103,882,177 H22L possibly damaging Het
Olfr730 A G 14: 50,187,197 S7P probably damaging Het
Pcdh15 A G 10: 74,450,313 D793G probably damaging Het
Rpap1 G A 2: 119,771,269 R737W probably damaging Het
Rpusd4 A G 9: 35,275,088 K307E probably benign Het
Shtn1 T A 19: 58,975,015 T623S probably benign Het
Sntg1 A G 1: 8,445,119 C397R possibly damaging Het
Stat5a T C 11: 100,881,060 F646S probably damaging Het
Tacc2 A G 7: 130,728,574 E196G possibly damaging Het
Tcf25 T C 8: 123,381,473 V89A probably benign Het
Trim7 G T 11: 48,849,705 V210L probably damaging Het
Vmn2r57 A G 7: 41,428,211 M177T possibly damaging Het
Wwc2 G A 8: 47,828,764 probably benign Het
Zfp28 A G 7: 6,389,780 I152V possibly damaging Het
Zfp628 A G 7: 4,920,183 H468R probably damaging Het
Zfp770 A G 2: 114,197,127 Y154H probably damaging Het
Other mutations in P2rx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0709:P2rx4 UTSW 5 122714404 missense probably damaging 1.00
R1464:P2rx4 UTSW 5 122714539 missense probably damaging 0.97
R1464:P2rx4 UTSW 5 122714539 missense probably damaging 0.97
R3434:P2rx4 UTSW 5 122725070 missense probably damaging 1.00
R3435:P2rx4 UTSW 5 122725070 missense probably damaging 1.00
R5090:P2rx4 UTSW 5 122725055 missense probably damaging 1.00
R5318:P2rx4 UTSW 5 122719148 missense probably null 1.00
R5888:P2rx4 UTSW 5 122719165 missense probably benign
R5888:P2rx4 UTSW 5 122727208 missense probably damaging 1.00
R5994:P2rx4 UTSW 5 122725079 missense probably damaging 1.00
R6450:P2rx4 UTSW 5 122727241 missense possibly damaging 0.88
R6478:P2rx4 UTSW 5 122707700 missense probably damaging 0.99
R6847:P2rx4 UTSW 5 122727751 missense probably damaging 1.00
X0064:P2rx4 UTSW 5 122707779 nonsense probably null
X0066:P2rx4 UTSW 5 122707745 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCACTGGAGCAACTCGTTAACCAAG -3'
(R):5'- TCTCTGCATCAGACTGGACTGAGAC -3'

Sequencing Primer
(F):5'- CGTTAACCAAGACAAGTTGTGC -3'
(R):5'- GCATCCAGTCTAGAGTCAAGTCTG -3'
Posted On2014-01-29