Incidental Mutation 'R1081:Gimap3'
ID152688
Institutional Source Beutler Lab
Gene Symbol Gimap3
Ensembl Gene ENSMUSG00000039264
Gene NameGTPase, IMAP family member 3
SynonymsIan4, 2010110D23Rik
MMRRC Submission 039167-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1081 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location48764464-48770851 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 48765152 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 281 (C281*)
Ref Sequence ENSEMBL: ENSMUSP00000145211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038811] [ENSMUST00000204036]
Predicted Effect probably null
Transcript: ENSMUST00000038811
AA Change: C281*
SMART Domains Protein: ENSMUSP00000047435
Gene: ENSMUSG00000039264
AA Change: C281*

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
Pfam:AIG1 23 234 1.5e-79 PFAM
Pfam:MMR_HSR1 24 147 5.3e-8 PFAM
transmembrane domain 280 299 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000204036
AA Change: C281*
SMART Domains Protein: ENSMUSP00000145211
Gene: ENSMUSG00000039264
AA Change: C281*

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
Pfam:AIG1 23 234 1.5e-79 PFAM
Pfam:MMR_HSR1 24 147 5.3e-8 PFAM
transmembrane domain 280 299 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a mitochondrial membrane protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. The expression of this gene is induced in BCR/ABL-expressing cells. The encoded protein lacks an N-terminal mitochondrial signal sequence. Experimental studies showed that mitochondrial localization relies on the C-terminal transmembrane domain. In humans, the IAN subfamily genes are located in a cluster at 7q36.1 [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,020 E309G probably benign Het
Abr T C 11: 76,455,615 K448E probably damaging Het
Atxn2l T C 7: 126,494,212 Y785C probably damaging Het
Atxn3 T G 12: 101,934,349 D225A probably damaging Het
BC049730 T C 7: 24,713,542 probably null Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cntnap5c A G 17: 58,305,525 D853G possibly damaging Het
Dnah9 A G 11: 66,084,877 Y1449H probably damaging Het
Dsc2 T G 18: 20,033,295 T760P probably damaging Het
Dync2h1 A T 9: 7,005,488 probably null Het
Epg5 T C 18: 77,959,533 F611L possibly damaging Het
Fat3 T C 9: 16,375,284 D981G possibly damaging Het
Ids T C X: 70,361,110 D149G possibly damaging Het
Inpp4b A G 8: 82,069,024 I826V probably damaging Het
Kcnrg C A 14: 61,607,714 H68N possibly damaging Het
Klra6 A G 6: 130,022,625 Y127H probably damaging Het
Mepce A G 5: 137,784,696 L456P probably damaging Het
Mink1 T C 11: 70,607,035 L488P probably benign Het
Mndal T A 1: 173,860,222 E482V probably benign Het
Mob1b G A 5: 88,753,162 V143I probably benign Het
Msh4 T C 3: 153,872,358 E433G probably benign Het
Myof A T 19: 37,986,088 I201N probably damaging Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ntsr1 G A 2: 180,538,756 S285N probably benign Het
Olfr319 C T 11: 58,702,498 H266Y probably damaging Het
Olfr598 A G 7: 103,329,038 Y184C probably damaging Het
Olfr66 T A 7: 103,882,177 H22L possibly damaging Het
Olfr730 A G 14: 50,187,197 S7P probably damaging Het
P2rx4 A G 5: 122,727,233 E307G probably damaging Het
Pcdh15 A G 10: 74,450,313 D793G probably damaging Het
Rpap1 G A 2: 119,771,269 R737W probably damaging Het
Rpusd4 A G 9: 35,275,088 K307E probably benign Het
Shtn1 T A 19: 58,975,015 T623S probably benign Het
Sntg1 A G 1: 8,445,119 C397R possibly damaging Het
Stat5a T C 11: 100,881,060 F646S probably damaging Het
Tacc2 A G 7: 130,728,574 E196G possibly damaging Het
Tcf25 T C 8: 123,381,473 V89A probably benign Het
Trim7 G T 11: 48,849,705 V210L probably damaging Het
Vmn2r57 A G 7: 41,428,211 M177T possibly damaging Het
Wwc2 G A 8: 47,828,764 probably benign Het
Zfp28 A G 7: 6,389,780 I152V possibly damaging Het
Zfp628 A G 7: 4,920,183 H468R probably damaging Het
Zfp770 A G 2: 114,197,127 Y154H probably damaging Het
Other mutations in Gimap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01763:Gimap3 APN 6 48765496 missense probably damaging 1.00
IGL02141:Gimap3 APN 6 48765378 missense probably benign 0.42
IGL02751:Gimap3 APN 6 48765238 missense probably benign
R0333:Gimap3 UTSW 6 48765730 nonsense probably null
R1911:Gimap3 UTSW 6 48765712 missense possibly damaging 0.80
R1936:Gimap3 UTSW 6 48765749 missense probably damaging 1.00
R2990:Gimap3 UTSW 6 48765851 missense probably damaging 0.98
R4052:Gimap3 UTSW 6 48766513 missense possibly damaging 0.53
R4433:Gimap3 UTSW 6 48765946 missense possibly damaging 0.53
R4571:Gimap3 UTSW 6 48765720 missense possibly damaging 0.74
R4672:Gimap3 UTSW 6 48765753 missense probably damaging 0.99
R4709:Gimap3 UTSW 6 48765393 missense probably benign 0.02
R5094:Gimap3 UTSW 6 48765372 missense probably damaging 1.00
R5510:Gimap3 UTSW 6 48765249 missense possibly damaging 0.93
R6876:Gimap3 UTSW 6 48765921 missense probably damaging 1.00
R7359:Gimap3 UTSW 6 48765346 missense probably benign 0.26
R7923:Gimap3 UTSW 6 48765627 missense probably benign 0.33
R8322:Gimap3 UTSW 6 48765436 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACATGGAGGAAGATCACCTTCCCC -3'
(R):5'- AGTTTGTGACCCACACTGACAACC -3'

Sequencing Primer
(F):5'- GGCAGGAAATGACAAACCTTTAC -3'
(R):5'- GTACTGTGCCTTCAACAACAGG -3'
Posted On2014-01-29