Incidental Mutation 'R1081:Klra6'
ID152691
Institutional Source Beutler Lab
Gene Symbol Klra6
Ensembl Gene ENSMUSG00000061769
Gene Namekiller cell lectin-like receptor, subfamily A, member 6
SynonymsLy49F, Ly49f
MMRRC Submission 039167-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R1081 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location130013033-130026954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130022625 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 127 (Y127H)
Ref Sequence ENSEMBL: ENSMUSP00000073700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074056]
Predicted Effect probably damaging
Transcript: ENSMUST00000074056
AA Change: Y127H

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073700
Gene: ENSMUSG00000061769
AA Change: Y127H

DomainStartEndE-ValueType
Blast:CLECT 73 123 3e-9 BLAST
CLECT 143 258 8.42e-18 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the highly polymorphic family of C-type lectin-like Ly49 genes that are expressed in natural killer (NK) cells. The encoded protein is a homodimeric type II transmembrane receptor located at the cell surface and inhibits NK cell activation upon ligand binding. This gene is located in a cluster of several Klra paralogs on chromosome 6. Different strains of mice show variation in the number of paralogs, including strain specific duplications, deletions and pseudogene sequences. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,020 E309G probably benign Het
Abr T C 11: 76,455,615 K448E probably damaging Het
Atxn2l T C 7: 126,494,212 Y785C probably damaging Het
Atxn3 T G 12: 101,934,349 D225A probably damaging Het
BC049730 T C 7: 24,713,542 probably null Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cntnap5c A G 17: 58,305,525 D853G possibly damaging Het
Dnah9 A G 11: 66,084,877 Y1449H probably damaging Het
Dsc2 T G 18: 20,033,295 T760P probably damaging Het
Dync2h1 A T 9: 7,005,488 probably null Het
Epg5 T C 18: 77,959,533 F611L possibly damaging Het
Fat3 T C 9: 16,375,284 D981G possibly damaging Het
Gimap3 A T 6: 48,765,152 C281* probably null Het
Ids T C X: 70,361,110 D149G possibly damaging Het
Inpp4b A G 8: 82,069,024 I826V probably damaging Het
Kcnrg C A 14: 61,607,714 H68N possibly damaging Het
Mepce A G 5: 137,784,696 L456P probably damaging Het
Mink1 T C 11: 70,607,035 L488P probably benign Het
Mndal T A 1: 173,860,222 E482V probably benign Het
Mob1b G A 5: 88,753,162 V143I probably benign Het
Msh4 T C 3: 153,872,358 E433G probably benign Het
Myof A T 19: 37,986,088 I201N probably damaging Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ntsr1 G A 2: 180,538,756 S285N probably benign Het
Olfr319 C T 11: 58,702,498 H266Y probably damaging Het
Olfr598 A G 7: 103,329,038 Y184C probably damaging Het
Olfr66 T A 7: 103,882,177 H22L possibly damaging Het
Olfr730 A G 14: 50,187,197 S7P probably damaging Het
P2rx4 A G 5: 122,727,233 E307G probably damaging Het
Pcdh15 A G 10: 74,450,313 D793G probably damaging Het
Rpap1 G A 2: 119,771,269 R737W probably damaging Het
Rpusd4 A G 9: 35,275,088 K307E probably benign Het
Shtn1 T A 19: 58,975,015 T623S probably benign Het
Sntg1 A G 1: 8,445,119 C397R possibly damaging Het
Stat5a T C 11: 100,881,060 F646S probably damaging Het
Tacc2 A G 7: 130,728,574 E196G possibly damaging Het
Tcf25 T C 8: 123,381,473 V89A probably benign Het
Trim7 G T 11: 48,849,705 V210L probably damaging Het
Vmn2r57 A G 7: 41,428,211 M177T possibly damaging Het
Wwc2 G A 8: 47,828,764 probably benign Het
Zfp28 A G 7: 6,389,780 I152V possibly damaging Het
Zfp628 A G 7: 4,920,183 H468R probably damaging Het
Zfp770 A G 2: 114,197,127 Y154H probably damaging Het
Other mutations in Klra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Klra6 APN 6 130023700 missense possibly damaging 0.77
IGL02037:Klra6 APN 6 130013476 missense probably benign 0.02
IGL02319:Klra6 APN 6 130025214 missense probably damaging 0.98
IGL02427:Klra6 APN 6 130016717 missense possibly damaging 0.54
IGL02730:Klra6 APN 6 130022697 missense probably benign
IGL02822:Klra6 APN 6 130016710 nonsense probably null
R0485:Klra6 UTSW 6 130023638 missense probably benign 0.12
R0697:Klra6 UTSW 6 130016724 missense probably benign 0.18
R0731:Klra6 UTSW 6 130022705 missense probably damaging 1.00
R1708:Klra6 UTSW 6 130022714 nonsense probably null
R1749:Klra6 UTSW 6 130018952 missense probably damaging 1.00
R1842:Klra6 UTSW 6 130022610 missense probably benign 0.14
R1944:Klra6 UTSW 6 130018945 missense possibly damaging 0.92
R4214:Klra6 UTSW 6 130018922 missense probably benign 0.10
R5210:Klra6 UTSW 6 130018892 nonsense probably null
R5286:Klra6 UTSW 6 130018969 missense probably benign 0.02
R5418:Klra6 UTSW 6 130013430 missense probably damaging 0.96
R5764:Klra6 UTSW 6 130022729 missense possibly damaging 0.92
R6193:Klra6 UTSW 6 130018918 missense probably benign 0.12
R6536:Klra6 UTSW 6 130023719 missense probably benign 0.07
R6696:Klra6 UTSW 6 130016733 missense probably benign
R7021:Klra6 UTSW 6 130018858 missense possibly damaging 0.93
R7718:Klra6 UTSW 6 130013352 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTCACTACAGGAAGTAAGGAACCCC -3'
(R):5'- TGCGTTGGCTGTCCTCATGAAG -3'

Sequencing Primer
(F):5'- GTAAGGAACCCCCAAATGATTAAC -3'
(R):5'- CTGCAGCAACATGCAAAGTGAT -3'
Posted On2014-01-29