Incidental Mutation 'R1081:Zfp628'
ID152692
Institutional Source Beutler Lab
Gene Symbol Zfp628
Ensembl Gene ENSMUSG00000074406
Gene Namezinc finger protein 628
SynonymsZec
MMRRC Submission 039167-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.626) question?
Stock #R1081 (G1)
Quality Score89
Status Not validated
Chromosome7
Chromosomal Location4915217-4922002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4920183 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 468 (H468R)
Ref Sequence ENSEMBL: ENSMUSP00000112058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047309] [ENSMUST00000116354] [ENSMUST00000207506] [ENSMUST00000207527] [ENSMUST00000207687] [ENSMUST00000208754]
Predicted Effect probably benign
Transcript: ENSMUST00000047309
SMART Domains Protein: ENSMUSP00000045354
Gene: ENSMUSG00000035285

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
Pfam:Acetyltransf_1 101 186 4.1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116354
AA Change: H468R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112058
Gene: ENSMUSG00000074406
AA Change: H468R

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
ZnF_C2H2 34 56 1.04e-3 SMART
ZnF_C2H2 62 84 2.4e-3 SMART
ZnF_C2H2 90 112 2.09e-3 SMART
ZnF_C2H2 118 140 1.56e-2 SMART
ZnF_C2H2 146 168 3.69e-4 SMART
ZnF_C2H2 174 196 7.49e-5 SMART
ZnF_C2H2 202 224 1.69e-3 SMART
low complexity region 225 238 N/A INTRINSIC
low complexity region 255 275 N/A INTRINSIC
ZnF_C2H2 289 309 1.38e2 SMART
low complexity region 334 344 N/A INTRINSIC
ZnF_C2H2 346 368 1.76e-1 SMART
ZnF_C2H2 376 398 9.3e-1 SMART
low complexity region 422 440 N/A INTRINSIC
ZnF_C2H2 446 468 2.75e-3 SMART
ZnF_C2H2 474 496 1.69e-3 SMART
ZnF_C2H2 502 524 1.45e-2 SMART
ZnF_C2H2 530 552 1.03e-2 SMART
ZnF_C2H2 558 580 3.44e-4 SMART
ZnF_C2H2 586 608 2.61e-4 SMART
ZnF_C2H2 614 636 7.9e-4 SMART
low complexity region 685 703 N/A INTRINSIC
low complexity region 716 756 N/A INTRINSIC
low complexity region 770 792 N/A INTRINSIC
low complexity region 981 1000 N/A INTRINSIC
low complexity region 1001 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207506
Predicted Effect probably benign
Transcript: ENSMUST00000207527
Predicted Effect probably benign
Transcript: ENSMUST00000207687
Predicted Effect probably benign
Transcript: ENSMUST00000208754
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc finger proteins (ZNFs), which bind nucleic acids, perform many key functions, the most important of which is regulating transcription. See ZNF91 (MIM 603971) for general information on ZNFs.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,020 E309G probably benign Het
Abr T C 11: 76,455,615 K448E probably damaging Het
Atxn2l T C 7: 126,494,212 Y785C probably damaging Het
Atxn3 T G 12: 101,934,349 D225A probably damaging Het
BC049730 T C 7: 24,713,542 probably null Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cntnap5c A G 17: 58,305,525 D853G possibly damaging Het
Dnah9 A G 11: 66,084,877 Y1449H probably damaging Het
Dsc2 T G 18: 20,033,295 T760P probably damaging Het
Dync2h1 A T 9: 7,005,488 probably null Het
Epg5 T C 18: 77,959,533 F611L possibly damaging Het
Fat3 T C 9: 16,375,284 D981G possibly damaging Het
Gimap3 A T 6: 48,765,152 C281* probably null Het
Ids T C X: 70,361,110 D149G possibly damaging Het
Inpp4b A G 8: 82,069,024 I826V probably damaging Het
Kcnrg C A 14: 61,607,714 H68N possibly damaging Het
Klra6 A G 6: 130,022,625 Y127H probably damaging Het
Mepce A G 5: 137,784,696 L456P probably damaging Het
Mink1 T C 11: 70,607,035 L488P probably benign Het
Mndal T A 1: 173,860,222 E482V probably benign Het
Mob1b G A 5: 88,753,162 V143I probably benign Het
Msh4 T C 3: 153,872,358 E433G probably benign Het
Myof A T 19: 37,986,088 I201N probably damaging Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ntsr1 G A 2: 180,538,756 S285N probably benign Het
Olfr319 C T 11: 58,702,498 H266Y probably damaging Het
Olfr598 A G 7: 103,329,038 Y184C probably damaging Het
Olfr66 T A 7: 103,882,177 H22L possibly damaging Het
Olfr730 A G 14: 50,187,197 S7P probably damaging Het
P2rx4 A G 5: 122,727,233 E307G probably damaging Het
Pcdh15 A G 10: 74,450,313 D793G probably damaging Het
Rpap1 G A 2: 119,771,269 R737W probably damaging Het
Rpusd4 A G 9: 35,275,088 K307E probably benign Het
Shtn1 T A 19: 58,975,015 T623S probably benign Het
Sntg1 A G 1: 8,445,119 C397R possibly damaging Het
Stat5a T C 11: 100,881,060 F646S probably damaging Het
Tacc2 A G 7: 130,728,574 E196G possibly damaging Het
Tcf25 T C 8: 123,381,473 V89A probably benign Het
Trim7 G T 11: 48,849,705 V210L probably damaging Het
Vmn2r57 A G 7: 41,428,211 M177T possibly damaging Het
Wwc2 G A 8: 47,828,764 probably benign Het
Zfp28 A G 7: 6,389,780 I152V possibly damaging Het
Zfp770 A G 2: 114,197,127 Y154H probably damaging Het
Other mutations in Zfp628
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Zfp628 APN 7 4920806 missense probably damaging 1.00
R0107:Zfp628 UTSW 7 4920168 missense probably damaging 1.00
R0110:Zfp628 UTSW 7 4919733 missense probably benign
R0450:Zfp628 UTSW 7 4919733 missense probably benign
R0469:Zfp628 UTSW 7 4919733 missense probably benign
R0480:Zfp628 UTSW 7 4921616 missense probably benign 0.00
R0518:Zfp628 UTSW 7 4919940 missense probably damaging 0.97
R0521:Zfp628 UTSW 7 4919940 missense probably damaging 0.97
R1846:Zfp628 UTSW 7 4920867 missense possibly damaging 0.52
R1938:Zfp628 UTSW 7 4920768 missense probably benign 0.00
R1997:Zfp628 UTSW 7 4918832 missense probably damaging 0.98
R2221:Zfp628 UTSW 7 4920831 missense probably benign 0.00
R2364:Zfp628 UTSW 7 4920687 missense probably damaging 1.00
R3077:Zfp628 UTSW 7 4921200 missense possibly damaging 0.88
R3964:Zfp628 UTSW 7 4921745 missense probably benign 0.00
R3966:Zfp628 UTSW 7 4921745 missense probably benign 0.00
R6058:Zfp628 UTSW 7 4920918 missense probably damaging 1.00
R6240:Zfp628 UTSW 7 4919849 missense possibly damaging 0.93
R6516:Zfp628 UTSW 7 4920202 nonsense probably null
R6962:Zfp628 UTSW 7 4919550 missense probably benign 0.03
R7180:Zfp628 UTSW 7 4921064 missense probably benign 0.18
R7347:Zfp628 UTSW 7 4921818 missense probably damaging 0.99
R7348:Zfp628 UTSW 7 4921818 missense probably damaging 0.99
R7349:Zfp628 UTSW 7 4921818 missense probably damaging 0.99
R8016:Zfp628 UTSW 7 4919229 missense probably damaging 1.00
R8074:Zfp628 UTSW 7 4920206 missense probably damaging 1.00
R8161:Zfp628 UTSW 7 4918959 missense probably damaging 1.00
R8328:Zfp628 UTSW 7 4919814 missense probably benign
RF018:Zfp628 UTSW 7 4920949 unclassified probably benign
X0022:Zfp628 UTSW 7 4919409 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGCTGCTGCTGAGACTACAG -3'
(R):5'- TGATAGTGGGACGACCACTTGAAGG -3'

Sequencing Primer
(F):5'- TTGGCTCACCAGCAGTGTC -3'
(R):5'- CACTTGAAGGTGAGGCCAC -3'
Posted On2014-01-29