Incidental Mutation 'R1081:Zfp28'
ID152693
Institutional Source Beutler Lab
Gene Symbol Zfp28
Ensembl Gene ENSMUSG00000062861
Gene Namezinc finger protein 28
Synonymsmkr-5, 2810438M17Rik, Zfp-28
MMRRC Submission 039167-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R1081 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location6383295-6396915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6389780 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 152 (I152V)
Ref Sequence ENSEMBL: ENSMUSP00000079812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081022]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081022
AA Change: I152V

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079812
Gene: ENSMUSG00000062861
AA Change: I152V

DomainStartEndE-ValueType
low complexity region 27 50 N/A INTRINSIC
KRAB 103 163 3.53e-33 SMART
ZnF_C2H2 377 399 3.95e-4 SMART
ZnF_C2H2 405 427 6.88e-4 SMART
ZnF_C2H2 433 456 1.2e-3 SMART
ZnF_C2H2 462 484 9.58e-3 SMART
ZnF_C2H2 490 512 2.57e-3 SMART
ZnF_C2H2 518 540 1.82e-3 SMART
ZnF_C2H2 546 568 2.4e-3 SMART
ZnF_C2H2 574 596 6.32e-3 SMART
ZnF_C2H2 602 624 1.38e-3 SMART
ZnF_C2H2 630 652 4.87e-4 SMART
ZnF_C2H2 658 680 2.91e-2 SMART
ZnF_C2H2 686 708 2.36e-2 SMART
ZnF_C2H2 714 736 6.42e-4 SMART
ZnF_C2H2 742 764 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207086
Predicted Effect unknown
Transcript: ENSMUST00000207465
AA Change: I17V
Predicted Effect probably benign
Transcript: ENSMUST00000207809
Predicted Effect unknown
Transcript: ENSMUST00000208338
AA Change: I9V
Predicted Effect probably benign
Transcript: ENSMUST00000208949
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,020 E309G probably benign Het
Abr T C 11: 76,455,615 K448E probably damaging Het
Atxn2l T C 7: 126,494,212 Y785C probably damaging Het
Atxn3 T G 12: 101,934,349 D225A probably damaging Het
BC049730 T C 7: 24,713,542 probably null Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cntnap5c A G 17: 58,305,525 D853G possibly damaging Het
Dnah9 A G 11: 66,084,877 Y1449H probably damaging Het
Dsc2 T G 18: 20,033,295 T760P probably damaging Het
Dync2h1 A T 9: 7,005,488 probably null Het
Epg5 T C 18: 77,959,533 F611L possibly damaging Het
Fat3 T C 9: 16,375,284 D981G possibly damaging Het
Gimap3 A T 6: 48,765,152 C281* probably null Het
Ids T C X: 70,361,110 D149G possibly damaging Het
Inpp4b A G 8: 82,069,024 I826V probably damaging Het
Kcnrg C A 14: 61,607,714 H68N possibly damaging Het
Klra6 A G 6: 130,022,625 Y127H probably damaging Het
Mepce A G 5: 137,784,696 L456P probably damaging Het
Mink1 T C 11: 70,607,035 L488P probably benign Het
Mndal T A 1: 173,860,222 E482V probably benign Het
Mob1b G A 5: 88,753,162 V143I probably benign Het
Msh4 T C 3: 153,872,358 E433G probably benign Het
Myof A T 19: 37,986,088 I201N probably damaging Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ntsr1 G A 2: 180,538,756 S285N probably benign Het
Olfr319 C T 11: 58,702,498 H266Y probably damaging Het
Olfr598 A G 7: 103,329,038 Y184C probably damaging Het
Olfr66 T A 7: 103,882,177 H22L possibly damaging Het
Olfr730 A G 14: 50,187,197 S7P probably damaging Het
P2rx4 A G 5: 122,727,233 E307G probably damaging Het
Pcdh15 A G 10: 74,450,313 D793G probably damaging Het
Rpap1 G A 2: 119,771,269 R737W probably damaging Het
Rpusd4 A G 9: 35,275,088 K307E probably benign Het
Shtn1 T A 19: 58,975,015 T623S probably benign Het
Sntg1 A G 1: 8,445,119 C397R possibly damaging Het
Stat5a T C 11: 100,881,060 F646S probably damaging Het
Tacc2 A G 7: 130,728,574 E196G possibly damaging Het
Tcf25 T C 8: 123,381,473 V89A probably benign Het
Trim7 G T 11: 48,849,705 V210L probably damaging Het
Vmn2r57 A G 7: 41,428,211 M177T possibly damaging Het
Wwc2 G A 8: 47,828,764 probably benign Het
Zfp628 A G 7: 4,920,183 H468R probably damaging Het
Zfp770 A G 2: 114,197,127 Y154H probably damaging Het
Other mutations in Zfp28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Zfp28 APN 7 6393430 makesense probably null
IGL02300:Zfp28 APN 7 6389496 missense probably benign 0.00
IGL02541:Zfp28 APN 7 6393480 nonsense probably null
FR4340:Zfp28 UTSW 7 6394863 missense probably damaging 1.00
FR4342:Zfp28 UTSW 7 6394863 missense probably damaging 1.00
R0442:Zfp28 UTSW 7 6394999 missense probably damaging 1.00
R0462:Zfp28 UTSW 7 6392240 missense possibly damaging 0.71
R0799:Zfp28 UTSW 7 6384183 missense possibly damaging 0.49
R1674:Zfp28 UTSW 7 6394943 missense possibly damaging 0.90
R1783:Zfp28 UTSW 7 6394792 missense probably damaging 1.00
R2119:Zfp28 UTSW 7 6394876 missense probably benign 0.00
R2186:Zfp28 UTSW 7 6394498 missense probably damaging 1.00
R4280:Zfp28 UTSW 7 6393701 missense probably benign 0.07
R4281:Zfp28 UTSW 7 6393701 missense probably benign 0.07
R4283:Zfp28 UTSW 7 6393701 missense probably benign 0.07
R4331:Zfp28 UTSW 7 6393701 missense probably benign 0.07
R4379:Zfp28 UTSW 7 6393442 missense probably benign 0.11
R4380:Zfp28 UTSW 7 6393442 missense probably benign 0.11
R4505:Zfp28 UTSW 7 6394161 missense probably damaging 1.00
R4659:Zfp28 UTSW 7 6393507 missense probably benign 0.05
R4706:Zfp28 UTSW 7 6389794 missense probably damaging 0.99
R5524:Zfp28 UTSW 7 6394851 splice site probably null
R6269:Zfp28 UTSW 7 6393613 missense probably benign 0.00
R6981:Zfp28 UTSW 7 6394693 missense probably damaging 1.00
R7117:Zfp28 UTSW 7 6394462 missense probably damaging 1.00
R7176:Zfp28 UTSW 7 6383457 missense possibly damaging 0.49
R7312:Zfp28 UTSW 7 6383594 unclassified probably benign
R7422:Zfp28 UTSW 7 6394749 missense probably damaging 1.00
R7423:Zfp28 UTSW 7 6393957 missense probably damaging 1.00
R7937:Zfp28 UTSW 7 6393786 missense probably damaging 1.00
R8110:Zfp28 UTSW 7 6389829 missense probably benign 0.02
Y4340:Zfp28 UTSW 7 6394657 missense probably damaging 1.00
Z1177:Zfp28 UTSW 7 6384187 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CATGCCTGTGGTAGTGGAACCTTC -3'
(R):5'- GCCCGCATTATGTGTTGCATGAG -3'

Sequencing Primer
(F):5'- GTGGAACCTTCCATTTATTCTCC -3'
(R):5'- tctgctgtcctcttctaccc -3'
Posted On2014-01-29