Incidental Mutation 'R1081:Olfr598'
ID152697
Institutional Source Beutler Lab
Gene Symbol Olfr598
Ensembl Gene ENSMUSG00000073951
Gene Nameolfactory receptor 598
SynonymsGA_x6K02T2PBJ9-6037823-6038782, MOR23-4P, MOR23-5
MMRRC Submission 039167-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R1081 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103323568-103329888 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103329038 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 184 (Y184C)
Ref Sequence ENSEMBL: ENSMUSP00000149199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098202] [ENSMUST00000214765]
Predicted Effect probably damaging
Transcript: ENSMUST00000098202
AA Change: Y184C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100474
Gene: ENSMUSG00000073951
AA Change: Y184C

DomainStartEndE-ValueType
Pfam:7tm_4 37 315 2.3e-89 PFAM
Pfam:7TM_GPCR_Srsx 41 312 9e-7 PFAM
Pfam:7tm_1 47 297 2e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214765
AA Change: Y184C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,020 E309G probably benign Het
Abr T C 11: 76,455,615 K448E probably damaging Het
Atxn2l T C 7: 126,494,212 Y785C probably damaging Het
Atxn3 T G 12: 101,934,349 D225A probably damaging Het
BC049730 T C 7: 24,713,542 probably null Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cntnap5c A G 17: 58,305,525 D853G possibly damaging Het
Dnah9 A G 11: 66,084,877 Y1449H probably damaging Het
Dsc2 T G 18: 20,033,295 T760P probably damaging Het
Dync2h1 A T 9: 7,005,488 probably null Het
Epg5 T C 18: 77,959,533 F611L possibly damaging Het
Fat3 T C 9: 16,375,284 D981G possibly damaging Het
Gimap3 A T 6: 48,765,152 C281* probably null Het
Ids T C X: 70,361,110 D149G possibly damaging Het
Inpp4b A G 8: 82,069,024 I826V probably damaging Het
Kcnrg C A 14: 61,607,714 H68N possibly damaging Het
Klra6 A G 6: 130,022,625 Y127H probably damaging Het
Mepce A G 5: 137,784,696 L456P probably damaging Het
Mink1 T C 11: 70,607,035 L488P probably benign Het
Mndal T A 1: 173,860,222 E482V probably benign Het
Mob1b G A 5: 88,753,162 V143I probably benign Het
Msh4 T C 3: 153,872,358 E433G probably benign Het
Myof A T 19: 37,986,088 I201N probably damaging Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ntsr1 G A 2: 180,538,756 S285N probably benign Het
Olfr319 C T 11: 58,702,498 H266Y probably damaging Het
Olfr66 T A 7: 103,882,177 H22L possibly damaging Het
Olfr730 A G 14: 50,187,197 S7P probably damaging Het
P2rx4 A G 5: 122,727,233 E307G probably damaging Het
Pcdh15 A G 10: 74,450,313 D793G probably damaging Het
Rpap1 G A 2: 119,771,269 R737W probably damaging Het
Rpusd4 A G 9: 35,275,088 K307E probably benign Het
Shtn1 T A 19: 58,975,015 T623S probably benign Het
Sntg1 A G 1: 8,445,119 C397R possibly damaging Het
Stat5a T C 11: 100,881,060 F646S probably damaging Het
Tacc2 A G 7: 130,728,574 E196G possibly damaging Het
Tcf25 T C 8: 123,381,473 V89A probably benign Het
Trim7 G T 11: 48,849,705 V210L probably damaging Het
Vmn2r57 A G 7: 41,428,211 M177T possibly damaging Het
Wwc2 G A 8: 47,828,764 probably benign Het
Zfp28 A G 7: 6,389,780 I152V possibly damaging Het
Zfp628 A G 7: 4,920,183 H468R probably damaging Het
Zfp770 A G 2: 114,197,127 Y154H probably damaging Het
Other mutations in Olfr598
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Olfr598 APN 7 103329321 missense probably damaging 1.00
IGL01911:Olfr598 APN 7 103329273 missense probably benign 0.30
IGL02225:Olfr598 APN 7 103329166 missense probably damaging 1.00
IGL02687:Olfr598 APN 7 103329400 nonsense probably null
IGL03214:Olfr598 APN 7 103328666 missense possibly damaging 0.95
R0544:Olfr598 UTSW 7 103328651 missense probably damaging 1.00
R0555:Olfr598 UTSW 7 103328963 missense probably benign
R1802:Olfr598 UTSW 7 103328647 missense probably benign 0.09
R2092:Olfr598 UTSW 7 103329109 missense probably damaging 1.00
R2197:Olfr598 UTSW 7 103328624 nonsense probably null
R3974:Olfr598 UTSW 7 103329078 missense probably damaging 0.98
R4227:Olfr598 UTSW 7 103328819 missense probably damaging 0.97
R4809:Olfr598 UTSW 7 103328523 nonsense probably null
R4977:Olfr598 UTSW 7 103328833 missense probably benign 0.00
R5324:Olfr598 UTSW 7 103329050 missense probably damaging 1.00
R5478:Olfr598 UTSW 7 103328825 missense probably damaging 1.00
R6238:Olfr598 UTSW 7 103328908 missense possibly damaging 0.95
R6797:Olfr598 UTSW 7 103329121 missense probably benign
R7062:Olfr598 UTSW 7 103329086 missense probably benign 0.10
R7079:Olfr598 UTSW 7 103329184 missense probably benign 0.00
R7539:Olfr598 UTSW 7 103328494 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTGATGCCTGCCTAGCCCAAC -3'
(R):5'- AAGATCTGTGCCACCCGCTTTC -3'

Sequencing Primer
(F):5'- CATACCCTTCAGGGCATGG -3'
(R):5'- TCACTCCATACACAATAGGGTTGAG -3'
Posted On2014-01-29