Mutagenetix > Incidental Mutations

Incidental Mutation 'R1081:Cdh15'

152704

Institutional Source

Beutler Lab

Gene Symbol

Cdh15

Ensembl Gene

ENSMUSG00000031962

Gene Name

cadherin 15

Synonyms

M cadherin, Mcad, Cdh14

MMRRC Submission

039167-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1081 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

122847966-122867397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 122857495 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glutamine at position 112 (E112Q)

Ref Sequence

ENSEMBL: ENSMUSP00000034443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034443
AA Change: E112Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: E112Q

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CA	64	149	5.95e-18	SMART
CA	173	257	3.09e-25	SMART
CA	280	373	2.5e-11	SMART
CA	396	480	3.45e-14	SMART
Pfam:Cadherin	486	579	5.2e-9	PFAM
transmembrane domain	603	625	N/A	INTRINSIC
Pfam:Cadherin_C	633	783	6.7e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Meta Mutation Damage Score

0.5702

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	A	G	6: 83,162,020	E309G	probably benign	Het
Abr	T	C	11: 76,455,615	K448E	probably damaging	Het
Atxn2l	T	C	7: 126,494,212	Y785C	probably damaging	Het
Atxn3	T	G	12: 101,934,349	D225A	probably damaging	Het
BC049730	T	C	7: 24,713,542		probably null	Het
Cntnap5c	A	G	17: 58,305,525	D853G	possibly damaging	Het
Dnah9	A	G	11: 66,084,877	Y1449H	probably damaging	Het
Dsc2	T	G	18: 20,033,295	T760P	probably damaging	Het
Dync2h1	A	T	9: 7,005,488		probably null	Het
Epg5	T	C	18: 77,959,533	F611L	possibly damaging	Het
Fat3	T	C	9: 16,375,284	D981G	possibly damaging	Het
Gimap3	A	T	6: 48,765,152	C281*	probably null	Het
Ids	T	C	X: 70,361,110	D149G	possibly damaging	Het
Inpp4b	A	G	8: 82,069,024	I826V	probably damaging	Het
Kcnrg	C	A	14: 61,607,714	H68N	possibly damaging	Het
Klra6	A	G	6: 130,022,625	Y127H	probably damaging	Het
Mepce	A	G	5: 137,784,696	L456P	probably damaging	Het
Mink1	T	C	11: 70,607,035	L488P	probably benign	Het
Mndal	T	A	1: 173,860,222	E482V	probably benign	Het
Mob1b	G	A	5: 88,753,162	V143I	probably benign	Het
Msh4	T	C	3: 153,872,358	E433G	probably benign	Het
Myof	A	T	19: 37,986,088	I201N	probably damaging	Het
Naip1	G	A	13: 100,423,070	S1142F	probably benign	Het
Ntsr1	G	A	2: 180,538,756	S285N	probably benign	Het
Olfr319	C	T	11: 58,702,498	H266Y	probably damaging	Het
Olfr598	A	G	7: 103,329,038	Y184C	probably damaging	Het
Olfr66	T	A	7: 103,882,177	H22L	possibly damaging	Het
Olfr730	A	G	14: 50,187,197	S7P	probably damaging	Het
P2rx4	A	G	5: 122,727,233	E307G	probably damaging	Het
Pcdh15	A	G	10: 74,450,313	D793G	probably damaging	Het
Rpap1	G	A	2: 119,771,269	R737W	probably damaging	Het
Rpusd4	A	G	9: 35,275,088	K307E	probably benign	Het
Shtn1	T	A	19: 58,975,015	T623S	probably benign	Het
Sntg1	A	G	1: 8,445,119	C397R	possibly damaging	Het
Stat5a	T	C	11: 100,881,060	F646S	probably damaging	Het
Tacc2	A	G	7: 130,728,574	E196G	possibly damaging	Het
Tcf25	T	C	8: 123,381,473	V89A	probably benign	Het
Trim7	G	T	11: 48,849,705	V210L	probably damaging	Het
Vmn2r57	A	G	7: 41,428,211	M177T	possibly damaging	Het
Wwc2	G	A	8: 47,828,764		probably benign	Het
Zfp28	A	G	7: 6,389,780	I152V	possibly damaging	Het
Zfp628	A	G	7: 4,920,183	H468R	probably damaging	Het
Zfp770	A	G	2: 114,197,127	Y154H	probably damaging	Het

Other mutations in Cdh15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cdh15	APN	8	122865323	intron	probably benign
IGL01958:Cdh15	APN	8	122859350	missense	probably damaging	1.00
IGL02588:Cdh15	APN	8	122856552	nonsense	probably null
IGL02793:Cdh15	APN	8	122860982	missense	probably damaging	1.00
IGL02947:Cdh15	APN	8	122865372	missense	probably benign	0.00
R0310:Cdh15	UTSW	8	122865436	missense	probably damaging	1.00
R0441:Cdh15	UTSW	8	122860966	missense	probably damaging	1.00
R0766:Cdh15	UTSW	8	122861449	intron	probably benign
R0898:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1023:Cdh15	UTSW	8	122865200	missense	probably damaging	0.98
R1054:Cdh15	UTSW	8	122864337	missense	possibly damaging	0.85
R1072:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R1101:Cdh15	UTSW	8	122860846	missense	possibly damaging	0.93
R1208:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1208:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1209:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1210:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1312:Cdh15	UTSW	8	122861449	intron	probably benign
R1317:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1318:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1393:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1428:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1429:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1695:Cdh15	UTSW	8	122862016	missense	probably benign	0.05
R2157:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2170:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2178:Cdh15	UTSW	8	122864976	splice site	probably null
R2252:Cdh15	UTSW	8	122857422	missense	probably damaging	1.00
R2290:Cdh15	UTSW	8	122859317	missense	probably damaging	1.00
R2317:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2330:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2345:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2349:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2353:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2354:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2566:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2567:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2568:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2893:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2894:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2937:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2938:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2990:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2992:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2993:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3029:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3030:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3195:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R3441:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3442:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3608:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3686:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R4119:Cdh15	UTSW	8	122863423	missense	probably damaging	1.00
R4120:Cdh15	UTSW	8	122863423	missense	probably damaging	1.00
R4477:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4478:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4480:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4580:Cdh15	UTSW	8	122865158	missense	probably damaging	0.99
R4583:Cdh15	UTSW	8	122865028	missense	probably damaging	0.98
R4619:Cdh15	UTSW	8	122860873	missense	probably damaging	1.00
R4694:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R4731:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R5076:Cdh15	UTSW	8	122864348	missense	possibly damaging	0.82
R5347:Cdh15	UTSW	8	122862063	missense	probably null	1.00
R5375:Cdh15	UTSW	8	122865100	missense	probably damaging	1.00
R5498:Cdh15	UTSW	8	122865178	missense	possibly damaging	0.79
R5778:Cdh15	UTSW	8	122856587	missense	possibly damaging	0.80
R6320:Cdh15	UTSW	8	122864347	missense	probably benign	0.01
R6570:Cdh15	UTSW	8	122857391	missense	probably damaging	1.00
R6708:Cdh15	UTSW	8	122863555	missense	probably benign	0.32
R7505:Cdh15	UTSW	8	122848492	missense	probably benign	0.01
R7527:Cdh15	UTSW	8	122862126	missense	probably damaging	1.00
R7724:Cdh15	UTSW	8	122866961	missense	probably damaging	1.00
R8093:Cdh15	UTSW	8	122866835	missense	probably damaging	1.00
R8485:Cdh15	UTSW	8	122857366	missense	probably damaging	1.00
Z1176:Cdh15	UTSW	8	122864259	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTCTGTTGGGGTGAAACACGAAG -3'
(R):5'- GTGATGCTCTGCTCTCCAAAAGACC -3'

Sequencing Primer
(F):5'- CACGAAGGTATTGGGGTGC -3'
(R):5'- ACCTATTCGCGGCCTCAAG -3'

Posted On

2014-01-29