Incidental Mutation 'R1081:Rpusd4'
ID152708
Institutional Source Beutler Lab
Gene Symbol Rpusd4
Ensembl Gene ENSMUSG00000032044
Gene NameRNA pseudouridylate synthase domain containing 4
Synonyms2410001E19Rik
MMRRC Submission 039167-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R1081 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location35267865-35277731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35275088 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 307 (K307E)
Ref Sequence ENSEMBL: ENSMUSP00000034543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034543]
Predicted Effect probably benign
Transcript: ENSMUST00000034543
AA Change: K307E

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034543
Gene: ENSMUSG00000032044
AA Change: K307E

DomainStartEndE-ValueType
Pfam:PseudoU_synth_2 105 277 5.5e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130552
Predicted Effect probably benign
Transcript: ENSMUST00000144582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146571
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,020 E309G probably benign Het
Abr T C 11: 76,455,615 K448E probably damaging Het
Atxn2l T C 7: 126,494,212 Y785C probably damaging Het
Atxn3 T G 12: 101,934,349 D225A probably damaging Het
BC049730 T C 7: 24,713,542 probably null Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cntnap5c A G 17: 58,305,525 D853G possibly damaging Het
Dnah9 A G 11: 66,084,877 Y1449H probably damaging Het
Dsc2 T G 18: 20,033,295 T760P probably damaging Het
Dync2h1 A T 9: 7,005,488 probably null Het
Epg5 T C 18: 77,959,533 F611L possibly damaging Het
Fat3 T C 9: 16,375,284 D981G possibly damaging Het
Gimap3 A T 6: 48,765,152 C281* probably null Het
Ids T C X: 70,361,110 D149G possibly damaging Het
Inpp4b A G 8: 82,069,024 I826V probably damaging Het
Kcnrg C A 14: 61,607,714 H68N possibly damaging Het
Klra6 A G 6: 130,022,625 Y127H probably damaging Het
Mepce A G 5: 137,784,696 L456P probably damaging Het
Mink1 T C 11: 70,607,035 L488P probably benign Het
Mndal T A 1: 173,860,222 E482V probably benign Het
Mob1b G A 5: 88,753,162 V143I probably benign Het
Msh4 T C 3: 153,872,358 E433G probably benign Het
Myof A T 19: 37,986,088 I201N probably damaging Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ntsr1 G A 2: 180,538,756 S285N probably benign Het
Olfr319 C T 11: 58,702,498 H266Y probably damaging Het
Olfr598 A G 7: 103,329,038 Y184C probably damaging Het
Olfr66 T A 7: 103,882,177 H22L possibly damaging Het
Olfr730 A G 14: 50,187,197 S7P probably damaging Het
P2rx4 A G 5: 122,727,233 E307G probably damaging Het
Pcdh15 A G 10: 74,450,313 D793G probably damaging Het
Rpap1 G A 2: 119,771,269 R737W probably damaging Het
Shtn1 T A 19: 58,975,015 T623S probably benign Het
Sntg1 A G 1: 8,445,119 C397R possibly damaging Het
Stat5a T C 11: 100,881,060 F646S probably damaging Het
Tacc2 A G 7: 130,728,574 E196G possibly damaging Het
Tcf25 T C 8: 123,381,473 V89A probably benign Het
Trim7 G T 11: 48,849,705 V210L probably damaging Het
Vmn2r57 A G 7: 41,428,211 M177T possibly damaging Het
Wwc2 G A 8: 47,828,764 probably benign Het
Zfp28 A G 7: 6,389,780 I152V possibly damaging Het
Zfp628 A G 7: 4,920,183 H468R probably damaging Het
Zfp770 A G 2: 114,197,127 Y154H probably damaging Het
Other mutations in Rpusd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Rpusd4 APN 9 35268442 missense probably benign 0.34
IGL00722:Rpusd4 APN 9 35268418 missense possibly damaging 0.66
IGL01657:Rpusd4 APN 9 35273461 unclassified probably benign
IGL01780:Rpusd4 APN 9 35268424 missense probably damaging 0.98
IGL03290:Rpusd4 APN 9 35267977 missense probably benign
R0607:Rpusd4 UTSW 9 35267993 missense possibly damaging 0.93
R1441:Rpusd4 UTSW 9 35272769 missense probably damaging 0.97
R2029:Rpusd4 UTSW 9 35268014 missense probably benign 0.00
R3929:Rpusd4 UTSW 9 35272580 missense probably benign 0.29
R4107:Rpusd4 UTSW 9 35275128 missense probably damaging 1.00
R4840:Rpusd4 UTSW 9 35268535 missense probably damaging 1.00
R5429:Rpusd4 UTSW 9 35272602 missense probably benign 0.01
R5801:Rpusd4 UTSW 9 35270073 missense possibly damaging 0.83
R5988:Rpusd4 UTSW 9 35272520 splice site probably null
R6318:Rpusd4 UTSW 9 35268038 missense probably damaging 1.00
R7819:Rpusd4 UTSW 9 35267932 missense probably benign
R7995:Rpusd4 UTSW 9 35272721 missense probably damaging 0.99
R8227:Rpusd4 UTSW 9 35268535 missense probably benign 0.22
R8246:Rpusd4 UTSW 9 35272580 missense probably benign 0.29
V1662:Rpusd4 UTSW 9 35272761 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGGCACCCATTTCTTAAAAGGCCAG -3'
(R):5'- CCAGCAGGCTTTCCCACATTACAG -3'

Sequencing Primer
(F):5'- CTCATCAATAAGTTTCTCTGGTATGG -3'
(R):5'- CTTGTCATCTGTTCCAAGTGAGAAG -3'
Posted On2014-01-29