Incidental Mutation 'R1081:Trim7'
ID152711
Institutional Source Beutler Lab
Gene Symbol Trim7
Ensembl Gene ENSMUSG00000040350
Gene Nametripartite motif-containing 7
Synonyms
MMRRC Submission 039167-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R1081 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location48826140-48852209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 48849705 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 210 (V210L)
Ref Sequence ENSEMBL: ENSMUSP00000104836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046903] [ENSMUST00000109213] [ENSMUST00000129674] [ENSMUST00000149049]
Predicted Effect probably damaging
Transcript: ENSMUST00000046903
AA Change: V417L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039011
Gene: ENSMUSG00000040350
AA Change: V417L

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
RING 29 80 2.95e-7 SMART
BBOX 124 165 3.23e-13 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 246 271 N/A INTRINSIC
low complexity region 285 304 N/A INTRINSIC
PRY 340 392 4.61e-18 SMART
SPRY 393 506 1.63e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109213
AA Change: V210L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104836
Gene: ENSMUSG00000040350
AA Change: V210L

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
coiled coil region 39 64 N/A INTRINSIC
low complexity region 78 97 N/A INTRINSIC
PRY 133 185 4.61e-18 SMART
SPRY 186 299 1.63e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129674
SMART Domains Protein: ENSMUSP00000116067
Gene: ENSMUSG00000040350

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131270
Predicted Effect probably benign
Transcript: ENSMUST00000149049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156882
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1, a B-box type 2, and a coiled-coil region. The protein localizes to both the nucleus and the cytoplasm, and may represent a participant in the initiation of glycogen synthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,020 E309G probably benign Het
Abr T C 11: 76,455,615 K448E probably damaging Het
Atxn2l T C 7: 126,494,212 Y785C probably damaging Het
Atxn3 T G 12: 101,934,349 D225A probably damaging Het
BC049730 T C 7: 24,713,542 probably null Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cntnap5c A G 17: 58,305,525 D853G possibly damaging Het
Dnah9 A G 11: 66,084,877 Y1449H probably damaging Het
Dsc2 T G 18: 20,033,295 T760P probably damaging Het
Dync2h1 A T 9: 7,005,488 probably null Het
Epg5 T C 18: 77,959,533 F611L possibly damaging Het
Fat3 T C 9: 16,375,284 D981G possibly damaging Het
Gimap3 A T 6: 48,765,152 C281* probably null Het
Ids T C X: 70,361,110 D149G possibly damaging Het
Inpp4b A G 8: 82,069,024 I826V probably damaging Het
Kcnrg C A 14: 61,607,714 H68N possibly damaging Het
Klra6 A G 6: 130,022,625 Y127H probably damaging Het
Mepce A G 5: 137,784,696 L456P probably damaging Het
Mink1 T C 11: 70,607,035 L488P probably benign Het
Mndal T A 1: 173,860,222 E482V probably benign Het
Mob1b G A 5: 88,753,162 V143I probably benign Het
Msh4 T C 3: 153,872,358 E433G probably benign Het
Myof A T 19: 37,986,088 I201N probably damaging Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ntsr1 G A 2: 180,538,756 S285N probably benign Het
Olfr319 C T 11: 58,702,498 H266Y probably damaging Het
Olfr598 A G 7: 103,329,038 Y184C probably damaging Het
Olfr66 T A 7: 103,882,177 H22L possibly damaging Het
Olfr730 A G 14: 50,187,197 S7P probably damaging Het
P2rx4 A G 5: 122,727,233 E307G probably damaging Het
Pcdh15 A G 10: 74,450,313 D793G probably damaging Het
Rpap1 G A 2: 119,771,269 R737W probably damaging Het
Rpusd4 A G 9: 35,275,088 K307E probably benign Het
Shtn1 T A 19: 58,975,015 T623S probably benign Het
Sntg1 A G 1: 8,445,119 C397R possibly damaging Het
Stat5a T C 11: 100,881,060 F646S probably damaging Het
Tacc2 A G 7: 130,728,574 E196G possibly damaging Het
Tcf25 T C 8: 123,381,473 V89A probably benign Het
Vmn2r57 A G 7: 41,428,211 M177T possibly damaging Het
Wwc2 G A 8: 47,828,764 probably benign Het
Zfp28 A G 7: 6,389,780 I152V possibly damaging Het
Zfp628 A G 7: 4,920,183 H468R probably damaging Het
Zfp770 A G 2: 114,197,127 Y154H probably damaging Het
Other mutations in Trim7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Trim7 APN 11 48845571 missense probably damaging 0.99
IGL00476:Trim7 APN 11 48848078 missense probably benign 0.39
R0119:Trim7 UTSW 11 48849712 missense probably damaging 1.00
R0308:Trim7 UTSW 11 48849501 missense probably damaging 0.96
R0546:Trim7 UTSW 11 48845509 missense probably damaging 1.00
R1067:Trim7 UTSW 11 48837819 missense probably damaging 0.99
R2139:Trim7 UTSW 11 48838894 missense probably benign 0.06
R3796:Trim7 UTSW 11 48845670 splice site probably null
R3797:Trim7 UTSW 11 48845670 splice site probably null
R3901:Trim7 UTSW 11 48837608 missense probably damaging 0.98
R4157:Trim7 UTSW 11 48848093 missense probably benign 0.00
R4603:Trim7 UTSW 11 48837528 start codon destroyed probably null 0.98
R5429:Trim7 UTSW 11 48849955 missense probably damaging 1.00
R5915:Trim7 UTSW 11 48845650 missense possibly damaging 0.95
R5988:Trim7 UTSW 11 48837686 missense probably benign 0.01
R7960:Trim7 UTSW 11 48837801 missense probably damaging 0.99
R8100:Trim7 UTSW 11 48849519 missense probably damaging 1.00
Z1176:Trim7 UTSW 11 48849893 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGATTGTAGAGGCAGCAGTGTG -3'
(R):5'- CTGACAGCTCTTCAAGGCCAGATTC -3'

Sequencing Primer
(F):5'- CCTCAGTGGAACTCACTTTGG -3'
(R):5'- AACACTCGCTCCTGGAAGTTG -3'
Posted On2014-01-29