Incidental Mutation 'R1081:Atxn3'
ID152719
Institutional Source Beutler Lab
Gene Symbol Atxn3
Ensembl Gene ENSMUSG00000021189
Gene Nameataxin 3
SynonymsSca3, ataxin-3, Atx3, MJD1, 2210008M02Rik, Mjd
MMRRC Submission 039167-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1081 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location101918901-101958246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 101934349 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 225 (D225A)
Ref Sequence ENSEMBL: ENSMUSP00000021606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021606] [ENSMUST00000159883] [ENSMUST00000160251] [ENSMUST00000161011]
Predicted Effect probably damaging
Transcript: ENSMUST00000021606
AA Change: D225A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021606
Gene: ENSMUSG00000021189
AA Change: D225A

DomainStartEndE-ValueType
Josephin 8 168 1.6e-91 SMART
UIM 224 243 2.23e-1 SMART
UIM 244 263 1.51e-3 SMART
low complexity region 276 286 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
UIM 329 348 7.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159883
AA Change: D221A

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124419
Gene: ENSMUSG00000021189
AA Change: D221A

DomainStartEndE-ValueType
Josephin 5 164 1.1e-89 SMART
UIM 220 239 2.23e-1 SMART
UIM 240 259 1.51e-3 SMART
low complexity region 272 282 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000160186
AA Change: D2A
SMART Domains Protein: ENSMUSP00000124178
Gene: ENSMUSG00000021189
AA Change: D2A

DomainStartEndE-ValueType
UIM 2 21 2.23e-1 SMART
UIM 22 41 1.51e-3 SMART
low complexity region 54 64 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160251
AA Change: D225A

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125082
Gene: ENSMUSG00000021189
AA Change: D225A

DomainStartEndE-ValueType
Josephin 8 168 1.6e-91 SMART
UIM 224 243 2.23e-1 SMART
UIM 244 263 8.77e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161011
AA Change: D225A

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125378
Gene: ENSMUSG00000021189
AA Change: D225A

DomainStartEndE-ValueType
Josephin 8 168 1.6e-91 SMART
UIM 224 243 2.23e-1 SMART
UIM 244 263 1.51e-3 SMART
low complexity region 276 286 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Machado-Joseph disease, also known as spinocerebellar ataxia-3, is an autosomal dominant neurologic disorder. The protein encoded by this gene contains (CAG)n repeats in the coding region, and the expansion of these repeats from the normal 12-44 to 52-86 is one cause of Machado-Joseph disease. There is a negative correlation between the age of onset and CAG repeat numbers. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Decreased exploratory behavior is reported for mice homozygous for a disruption of this marker. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,020 E309G probably benign Het
Abr T C 11: 76,455,615 K448E probably damaging Het
Atxn2l T C 7: 126,494,212 Y785C probably damaging Het
BC049730 T C 7: 24,713,542 probably null Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cntnap5c A G 17: 58,305,525 D853G possibly damaging Het
Dnah9 A G 11: 66,084,877 Y1449H probably damaging Het
Dsc2 T G 18: 20,033,295 T760P probably damaging Het
Dync2h1 A T 9: 7,005,488 probably null Het
Epg5 T C 18: 77,959,533 F611L possibly damaging Het
Fat3 T C 9: 16,375,284 D981G possibly damaging Het
Gimap3 A T 6: 48,765,152 C281* probably null Het
Ids T C X: 70,361,110 D149G possibly damaging Het
Inpp4b A G 8: 82,069,024 I826V probably damaging Het
Kcnrg C A 14: 61,607,714 H68N possibly damaging Het
Klra6 A G 6: 130,022,625 Y127H probably damaging Het
Mepce A G 5: 137,784,696 L456P probably damaging Het
Mink1 T C 11: 70,607,035 L488P probably benign Het
Mndal T A 1: 173,860,222 E482V probably benign Het
Mob1b G A 5: 88,753,162 V143I probably benign Het
Msh4 T C 3: 153,872,358 E433G probably benign Het
Myof A T 19: 37,986,088 I201N probably damaging Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ntsr1 G A 2: 180,538,756 S285N probably benign Het
Olfr319 C T 11: 58,702,498 H266Y probably damaging Het
Olfr598 A G 7: 103,329,038 Y184C probably damaging Het
Olfr66 T A 7: 103,882,177 H22L possibly damaging Het
Olfr730 A G 14: 50,187,197 S7P probably damaging Het
P2rx4 A G 5: 122,727,233 E307G probably damaging Het
Pcdh15 A G 10: 74,450,313 D793G probably damaging Het
Rpap1 G A 2: 119,771,269 R737W probably damaging Het
Rpusd4 A G 9: 35,275,088 K307E probably benign Het
Shtn1 T A 19: 58,975,015 T623S probably benign Het
Sntg1 A G 1: 8,445,119 C397R possibly damaging Het
Stat5a T C 11: 100,881,060 F646S probably damaging Het
Tacc2 A G 7: 130,728,574 E196G possibly damaging Het
Tcf25 T C 8: 123,381,473 V89A probably benign Het
Trim7 G T 11: 48,849,705 V210L probably damaging Het
Vmn2r57 A G 7: 41,428,211 M177T possibly damaging Het
Wwc2 G A 8: 47,828,764 probably benign Het
Zfp28 A G 7: 6,389,780 I152V possibly damaging Het
Zfp628 A G 7: 4,920,183 H468R probably damaging Het
Zfp770 A G 2: 114,197,127 Y154H probably damaging Het
Other mutations in Atxn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Atxn3 APN 12 101926508 missense possibly damaging 0.94
IGL01364:Atxn3 APN 12 101934423 splice site probably benign
IGL01393:Atxn3 APN 12 101933047 nonsense probably null
IGL01994:Atxn3 APN 12 101942180 missense probably benign
IGL03214:Atxn3 APN 12 101945922 splice site probably benign
R1255:Atxn3 UTSW 12 101934334 missense probably damaging 1.00
R1288:Atxn3 UTSW 12 101942178 splice site probably null
R1435:Atxn3 UTSW 12 101942201 missense probably benign 0.18
R1466:Atxn3 UTSW 12 101926499 missense possibly damaging 0.73
R1466:Atxn3 UTSW 12 101926499 missense possibly damaging 0.73
R2032:Atxn3 UTSW 12 101942194 nonsense probably null
R2345:Atxn3 UTSW 12 101948321 missense probably damaging 1.00
R2882:Atxn3 UTSW 12 101937411 missense probably damaging 1.00
R4593:Atxn3 UTSW 12 101923177 missense probably benign 0.01
R4628:Atxn3 UTSW 12 101923078 unclassified probably benign
R4849:Atxn3 UTSW 12 101934368 missense probably benign 0.02
R4876:Atxn3 UTSW 12 101948379 missense probably damaging 1.00
R4960:Atxn3 UTSW 12 101948379 missense possibly damaging 0.92
R5682:Atxn3 UTSW 12 101958147 missense probably damaging 1.00
R6010:Atxn3 UTSW 12 101948026 missense probably damaging 1.00
R6520:Atxn3 UTSW 12 101934401 missense probably damaging 1.00
R6629:Atxn3 UTSW 12 101937406 missense probably benign 0.11
R7460:Atxn3 UTSW 12 101926517 missense probably benign 0.15
R7546:Atxn3 UTSW 12 101948002 critical splice donor site probably null
X0061:Atxn3 UTSW 12 101958139 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTAAGGACGTGATCCACTTCTCCAAA -3'
(R):5'- TCAGCACTCAGTTGTTGTTAGTAGACCT -3'

Sequencing Primer
(F):5'- GTGATCCACTTCTCCAAAAATGAC -3'
(R):5'- cacccacctgctcgctc -3'
Posted On2014-01-29