Incidental Mutation 'R1081:Kcnrg'
ID152723
Institutional Source Beutler Lab
Gene Symbol Kcnrg
Ensembl Gene ENSMUSG00000046168
Gene Namepotassium channel regulator
SynonymsE030012H22Rik, LOC328424
MMRRC Submission 039167-MU
Accession Numbers

Genbank: NM_001039105, NM_206974; MGI: 2685591

Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R1081 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location61607457-61612826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 61607714 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 68 (H68N)
Ref Sequence ENSEMBL: ENSMUSP00000153429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039562] [ENSMUST00000051184] [ENSMUST00000165015] [ENSMUST00000225582]
Predicted Effect probably benign
Transcript: ENSMUST00000039562
SMART Domains Protein: ENSMUSP00000045009
Gene: ENSMUSG00000035235

DomainStartEndE-ValueType
RING 10 57 1.31e-8 SMART
BBOX 89 131 5.55e-12 SMART
transmembrane domain 316 338 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000051184
AA Change: H68N

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000055327
Gene: ENSMUSG00000046168
AA Change: H68N

DomainStartEndE-ValueType
BTB 5 106 8.7e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165015
SMART Domains Protein: ENSMUSP00000128509
Gene: ENSMUSG00000035235

DomainStartEndE-ValueType
RING 10 57 1.31e-8 SMART
BBOX 89 131 5.55e-12 SMART
transmembrane domain 316 338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183066
Predicted Effect possibly damaging
Transcript: ENSMUST00000225582
AA Change: H68N

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which regulates the activity of voltage-gated potassium channels. This gene is on chromosome 13 and overlaps the gene for tripartite motif containing 13 on the same strand. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,020 E309G probably benign Het
Abr T C 11: 76,455,615 K448E probably damaging Het
Atxn2l T C 7: 126,494,212 Y785C probably damaging Het
Atxn3 T G 12: 101,934,349 D225A probably damaging Het
BC049730 T C 7: 24,713,542 probably null Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cntnap5c A G 17: 58,305,525 D853G possibly damaging Het
Dnah9 A G 11: 66,084,877 Y1449H probably damaging Het
Dsc2 T G 18: 20,033,295 T760P probably damaging Het
Dync2h1 A T 9: 7,005,488 probably null Het
Epg5 T C 18: 77,959,533 F611L possibly damaging Het
Fat3 T C 9: 16,375,284 D981G possibly damaging Het
Gimap3 A T 6: 48,765,152 C281* probably null Het
Ids T C X: 70,361,110 D149G possibly damaging Het
Inpp4b A G 8: 82,069,024 I826V probably damaging Het
Klra6 A G 6: 130,022,625 Y127H probably damaging Het
Mepce A G 5: 137,784,696 L456P probably damaging Het
Mink1 T C 11: 70,607,035 L488P probably benign Het
Mndal T A 1: 173,860,222 E482V probably benign Het
Mob1b G A 5: 88,753,162 V143I probably benign Het
Msh4 T C 3: 153,872,358 E433G probably benign Het
Myof A T 19: 37,986,088 I201N probably damaging Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ntsr1 G A 2: 180,538,756 S285N probably benign Het
Olfr319 C T 11: 58,702,498 H266Y probably damaging Het
Olfr598 A G 7: 103,329,038 Y184C probably damaging Het
Olfr66 T A 7: 103,882,177 H22L possibly damaging Het
Olfr730 A G 14: 50,187,197 S7P probably damaging Het
P2rx4 A G 5: 122,727,233 E307G probably damaging Het
Pcdh15 A G 10: 74,450,313 D793G probably damaging Het
Rpap1 G A 2: 119,771,269 R737W probably damaging Het
Rpusd4 A G 9: 35,275,088 K307E probably benign Het
Shtn1 T A 19: 58,975,015 T623S probably benign Het
Sntg1 A G 1: 8,445,119 C397R possibly damaging Het
Stat5a T C 11: 100,881,060 F646S probably damaging Het
Tacc2 A G 7: 130,728,574 E196G possibly damaging Het
Tcf25 T C 8: 123,381,473 V89A probably benign Het
Trim7 G T 11: 48,849,705 V210L probably damaging Het
Vmn2r57 A G 7: 41,428,211 M177T possibly damaging Het
Wwc2 G A 8: 47,828,764 probably benign Het
Zfp28 A G 7: 6,389,780 I152V possibly damaging Het
Zfp628 A G 7: 4,920,183 H468R probably damaging Het
Zfp770 A G 2: 114,197,127 Y154H probably damaging Het
Other mutations in Kcnrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Kcnrg APN 14 61607910 missense probably damaging 1.00
IGL01311:Kcnrg APN 14 61611825 missense probably damaging 1.00
D4216:Kcnrg UTSW 14 61611793 nonsense probably null
R1346:Kcnrg UTSW 14 61611695 missense probably benign 0.31
R3147:Kcnrg UTSW 14 61607691 missense probably damaging 1.00
R4690:Kcnrg UTSW 14 61611727 missense probably damaging 1.00
R4820:Kcnrg UTSW 14 61607937 missense probably benign 0.39
R5068:Kcnrg UTSW 14 61607817 missense probably damaging 1.00
R5914:Kcnrg UTSW 14 61611831 missense probably benign
R7234:Kcnrg UTSW 14 61608082 missense unknown
R8232:Kcnrg UTSW 14 61607937 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GGTCAGGACCTCGTCACTTTGAATG -3'
(R):5'- TGCTGTGGGTCGCTCTACAAAC -3'

Sequencing Primer
(F):5'- CTCGTCACTTTGAATGTGGGAG -3'
(R):5'- TTTTGCTGCAAGAGCCAAAC -3'
Posted On2014-01-29