Mutagenetix > Incidental Mutations

Incidental Mutation 'R1081:Kcnrg'

152723

Institutional Source

Beutler Lab

Gene Symbol

Kcnrg

Ensembl Gene

ENSMUSG00000046168

Gene Name

potassium channel regulator

Synonyms

E030012H22Rik, LOC328424

MMRRC Submission

039167-MU

Accession Numbers

Genbank: NM_001039105, NM_206974; MGI: 2685591

Is this an essential gene?

Probably non essential (E-score: 0.249) question?

Stock #

R1081 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

61607457-61612826 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 61607714 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 68 (H68N)

Ref Sequence

ENSEMBL: ENSMUSP00000153429 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039562] [ENSMUST00000051184] [ENSMUST00000165015] [ENSMUST00000225582]

Predicted Effect

probably benign
Transcript: ENSMUST00000039562

SMART Domains

Protein: ENSMUSP00000045009
Gene: ENSMUSG00000035235

Domain	Start	End	E-Value	Type
RING	10	57	1.31e-8	SMART
BBOX	89	131	5.55e-12	SMART
transmembrane domain	316	338	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000051184
AA Change: H68N

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000055327
Gene: ENSMUSG00000046168
AA Change: H68N

Domain	Start	End	E-Value	Type
BTB	5	106	8.7e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165015

SMART Domains

Protein: ENSMUSP00000128509
Gene: ENSMUSG00000035235

Domain	Start	End	E-Value	Type
RING	10	57	1.31e-8	SMART
BBOX	89	131	5.55e-12	SMART
transmembrane domain	316	338	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182259

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182325

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182768

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183054

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183066

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225582
AA Change: H68N

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which regulates the activity of voltage-gated potassium channels. This gene is on chromosome 13 and overlaps the gene for tripartite motif containing 13 on the same strand. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]

Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	A	G	6: 83,162,020	E309G	probably benign	Het
Abr	T	C	11: 76,455,615	K448E	probably damaging	Het
Atxn2l	T	C	7: 126,494,212	Y785C	probably damaging	Het
Atxn3	T	G	12: 101,934,349	D225A	probably damaging	Het
BC049730	T	C	7: 24,713,542		probably null	Het
Cdh15	G	C	8: 122,857,495	E112Q	probably damaging	Het
Cntnap5c	A	G	17: 58,305,525	D853G	possibly damaging	Het
Dnah9	A	G	11: 66,084,877	Y1449H	probably damaging	Het
Dsc2	T	G	18: 20,033,295	T760P	probably damaging	Het
Dync2h1	A	T	9: 7,005,488		probably null	Het
Epg5	T	C	18: 77,959,533	F611L	possibly damaging	Het
Fat3	T	C	9: 16,375,284	D981G	possibly damaging	Het
Gimap3	A	T	6: 48,765,152	C281*	probably null	Het
Ids	T	C	X: 70,361,110	D149G	possibly damaging	Het
Inpp4b	A	G	8: 82,069,024	I826V	probably damaging	Het
Klra6	A	G	6: 130,022,625	Y127H	probably damaging	Het
Mepce	A	G	5: 137,784,696	L456P	probably damaging	Het
Mink1	T	C	11: 70,607,035	L488P	probably benign	Het
Mndal	T	A	1: 173,860,222	E482V	probably benign	Het
Mob1b	G	A	5: 88,753,162	V143I	probably benign	Het
Msh4	T	C	3: 153,872,358	E433G	probably benign	Het
Myof	A	T	19: 37,986,088	I201N	probably damaging	Het
Naip1	G	A	13: 100,423,070	S1142F	probably benign	Het
Ntsr1	G	A	2: 180,538,756	S285N	probably benign	Het
Olfr319	C	T	11: 58,702,498	H266Y	probably damaging	Het
Olfr598	A	G	7: 103,329,038	Y184C	probably damaging	Het
Olfr66	T	A	7: 103,882,177	H22L	possibly damaging	Het
Olfr730	A	G	14: 50,187,197	S7P	probably damaging	Het
P2rx4	A	G	5: 122,727,233	E307G	probably damaging	Het
Pcdh15	A	G	10: 74,450,313	D793G	probably damaging	Het
Rpap1	G	A	2: 119,771,269	R737W	probably damaging	Het
Rpusd4	A	G	9: 35,275,088	K307E	probably benign	Het
Shtn1	T	A	19: 58,975,015	T623S	probably benign	Het
Sntg1	A	G	1: 8,445,119	C397R	possibly damaging	Het
Stat5a	T	C	11: 100,881,060	F646S	probably damaging	Het
Tacc2	A	G	7: 130,728,574	E196G	possibly damaging	Het
Tcf25	T	C	8: 123,381,473	V89A	probably benign	Het
Trim7	G	T	11: 48,849,705	V210L	probably damaging	Het
Vmn2r57	A	G	7: 41,428,211	M177T	possibly damaging	Het
Wwc2	G	A	8: 47,828,764		probably benign	Het
Zfp28	A	G	7: 6,389,780	I152V	possibly damaging	Het
Zfp628	A	G	7: 4,920,183	H468R	probably damaging	Het
Zfp770	A	G	2: 114,197,127	Y154H	probably damaging	Het

Other mutations in Kcnrg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00595:Kcnrg	APN	14	61607910	missense	probably damaging	1.00
IGL01311:Kcnrg	APN	14	61611825	missense	probably damaging	1.00
D4216:Kcnrg	UTSW	14	61611793	nonsense	probably null
R1346:Kcnrg	UTSW	14	61611695	missense	probably benign	0.31
R3147:Kcnrg	UTSW	14	61607691	missense	probably damaging	1.00
R4690:Kcnrg	UTSW	14	61611727	missense	probably damaging	1.00
R4820:Kcnrg	UTSW	14	61607937	missense	probably benign	0.39
R5068:Kcnrg	UTSW	14	61607817	missense	probably damaging	1.00
R5914:Kcnrg	UTSW	14	61611831	missense	probably benign
R7234:Kcnrg	UTSW	14	61608082	missense	unknown
R8232:Kcnrg	UTSW	14	61607937	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- GGTCAGGACCTCGTCACTTTGAATG -3'
(R):5'- TGCTGTGGGTCGCTCTACAAAC -3'

Sequencing Primer
(F):5'- CTCGTCACTTTGAATGTGGGAG -3'
(R):5'- TTTTGCTGCAAGAGCCAAAC -3'

Posted On

2014-01-29