Mutagenetix > Incidental Mutations

Incidental Mutation 'R1081:Cntnap5c'

152724

Institutional Source

Beutler Lab

Gene Symbol

Cntnap5c

Ensembl Gene

ENSMUSG00000038048

Gene Name

contactin associated protein-like 5C

Synonyms

MMRRC Submission

039167-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R1081 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57769570-58410355 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58305525 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 853 (D853G)

Ref Sequence

ENSEMBL: ENSMUSP00000075416 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076038]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000076038
AA Change: D853G

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000075416
Gene: ENSMUSG00000038048
AA Change: D853G

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
FA58C	29	174	1.26e-10	SMART
LamG	201	338	1.57e-29	SMART
LamG	387	521	3e-26	SMART
EGF	549	583	1.88e-1	SMART
Blast:FBG	586	769	8e-83	BLAST
LamG	811	938	4.37e-28	SMART
EGF	959	995	6.55e-1	SMART
LamG	1036	1172	2.08e-11	SMART
transmembrane domain	1240	1262	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	A	G	6: 83,162,020	E309G	probably benign	Het
Abr	T	C	11: 76,455,615	K448E	probably damaging	Het
Atxn2l	T	C	7: 126,494,212	Y785C	probably damaging	Het
Atxn3	T	G	12: 101,934,349	D225A	probably damaging	Het
BC049730	T	C	7: 24,713,542		probably null	Het
Cdh15	G	C	8: 122,857,495	E112Q	probably damaging	Het
Dnah9	A	G	11: 66,084,877	Y1449H	probably damaging	Het
Dsc2	T	G	18: 20,033,295	T760P	probably damaging	Het
Dync2h1	A	T	9: 7,005,488		probably null	Het
Epg5	T	C	18: 77,959,533	F611L	possibly damaging	Het
Fat3	T	C	9: 16,375,284	D981G	possibly damaging	Het
Gimap3	A	T	6: 48,765,152	C281*	probably null	Het
Ids	T	C	X: 70,361,110	D149G	possibly damaging	Het
Inpp4b	A	G	8: 82,069,024	I826V	probably damaging	Het
Kcnrg	C	A	14: 61,607,714	H68N	possibly damaging	Het
Klra6	A	G	6: 130,022,625	Y127H	probably damaging	Het
Mepce	A	G	5: 137,784,696	L456P	probably damaging	Het
Mink1	T	C	11: 70,607,035	L488P	probably benign	Het
Mndal	T	A	1: 173,860,222	E482V	probably benign	Het
Mob1b	G	A	5: 88,753,162	V143I	probably benign	Het
Msh4	T	C	3: 153,872,358	E433G	probably benign	Het
Myof	A	T	19: 37,986,088	I201N	probably damaging	Het
Naip1	G	A	13: 100,423,070	S1142F	probably benign	Het
Ntsr1	G	A	2: 180,538,756	S285N	probably benign	Het
Olfr319	C	T	11: 58,702,498	H266Y	probably damaging	Het
Olfr598	A	G	7: 103,329,038	Y184C	probably damaging	Het
Olfr66	T	A	7: 103,882,177	H22L	possibly damaging	Het
Olfr730	A	G	14: 50,187,197	S7P	probably damaging	Het
P2rx4	A	G	5: 122,727,233	E307G	probably damaging	Het
Pcdh15	A	G	10: 74,450,313	D793G	probably damaging	Het
Rpap1	G	A	2: 119,771,269	R737W	probably damaging	Het
Rpusd4	A	G	9: 35,275,088	K307E	probably benign	Het
Shtn1	T	A	19: 58,975,015	T623S	probably benign	Het
Sntg1	A	G	1: 8,445,119	C397R	possibly damaging	Het
Stat5a	T	C	11: 100,881,060	F646S	probably damaging	Het
Tacc2	A	G	7: 130,728,574	E196G	possibly damaging	Het
Tcf25	T	C	8: 123,381,473	V89A	probably benign	Het
Trim7	G	T	11: 48,849,705	V210L	probably damaging	Het
Vmn2r57	A	G	7: 41,428,211	M177T	possibly damaging	Het
Wwc2	G	A	8: 47,828,764		probably benign	Het
Zfp28	A	G	7: 6,389,780	I152V	possibly damaging	Het
Zfp628	A	G	7: 4,920,183	H468R	probably damaging	Het
Zfp770	A	G	2: 114,197,127	Y154H	probably damaging	Het

Other mutations in Cntnap5c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00495:Cntnap5c	APN	17	58162277	missense	probably benign	0.00
IGL00543:Cntnap5c	APN	17	58294350	missense	probably benign
IGL00679:Cntnap5c	APN	17	58055678	missense	probably damaging	0.98
IGL00942:Cntnap5c	APN	17	57769598	missense	probably benign	0.03
IGL01352:Cntnap5c	APN	17	58293901	missense	probably benign	0.00
IGL01822:Cntnap5c	APN	17	58055705	missense	probably damaging	0.99
IGL01864:Cntnap5c	APN	17	58410242	missense	probably benign
IGL01922:Cntnap5c	APN	17	58330119	missense	possibly damaging	0.95
IGL02111:Cntnap5c	APN	17	58102108	missense	probably damaging	1.00
IGL02112:Cntnap5c	APN	17	58313858	missense	probably benign	0.00
IGL02259:Cntnap5c	APN	17	58034862	missense	probably damaging	0.98
IGL02270:Cntnap5c	APN	17	58034853	missense	probably benign	0.08
IGL02312:Cntnap5c	APN	17	58138699	missense	probably benign	0.09
IGL02456:Cntnap5c	APN	17	58407744	splice site	probably benign
IGL02755:Cntnap5c	APN	17	58364194	missense	probably benign	0.02
IGL02955:Cntnap5c	APN	17	57892102	splice site	probably benign
IGL03001:Cntnap5c	APN	17	58055639	missense	probably damaging	1.00
IGL03012:Cntnap5c	APN	17	58359234	missense	probably benign	0.01
IGL03243:Cntnap5c	APN	17	58102176	missense	probably benign	0.01
IGL03375:Cntnap5c	APN	17	58162205	missense	possibly damaging	0.94
IGL02802:Cntnap5c	UTSW	17	58305684	missense	probably benign	0.04
LCD18:Cntnap5c	UTSW	17	58162160	intron	probably benign
R0003:Cntnap5c	UTSW	17	58199017	missense	probably benign
R0041:Cntnap5c	UTSW	17	57876469	missense	probably benign	0.00
R0041:Cntnap5c	UTSW	17	57876469	missense	probably benign	0.00
R0046:Cntnap5c	UTSW	17	58359300	missense	probably benign
R0046:Cntnap5c	UTSW	17	58359300	missense	probably benign
R0179:Cntnap5c	UTSW	17	57769625	missense	probably benign	0.19
R0244:Cntnap5c	UTSW	17	58102168	missense	probably damaging	1.00
R0445:Cntnap5c	UTSW	17	58104743	missense	probably benign	0.01
R0626:Cntnap5c	UTSW	17	58042427	missense	probably benign	0.29
R0675:Cntnap5c	UTSW	17	58034995	missense	probably damaging	1.00
R0681:Cntnap5c	UTSW	17	58305555	missense	possibly damaging	0.91
R0699:Cntnap5c	UTSW	17	58042498	missense	probably damaging	1.00
R0927:Cntnap5c	UTSW	17	58042558	missense	possibly damaging	0.78
R1132:Cntnap5c	UTSW	17	58294356	missense	probably damaging	1.00
R1175:Cntnap5c	UTSW	17	58364246	missense	possibly damaging	0.51
R1640:Cntnap5c	UTSW	17	58395294	missense	probably benign	0.01
R1664:Cntnap5c	UTSW	17	58293990	missense	probably benign	0.00
R1758:Cntnap5c	UTSW	17	58042550	missense	probably damaging	1.00
R1785:Cntnap5c	UTSW	17	58162291	missense	probably benign	0.00
R1789:Cntnap5c	UTSW	17	58013921	missense	probably damaging	1.00
R1968:Cntnap5c	UTSW	17	58359296	missense	probably damaging	1.00
R2041:Cntnap5c	UTSW	17	58104770	critical splice donor site	probably null
R2041:Cntnap5c	UTSW	17	58198989	missense	probably benign	0.02
R2073:Cntnap5c	UTSW	17	58305552	missense	possibly damaging	0.58
R2093:Cntnap5c	UTSW	17	58199000	missense	probably benign	0.00
R2134:Cntnap5c	UTSW	17	58407722	missense	probably damaging	1.00
R2153:Cntnap5c	UTSW	17	58055671	missense	possibly damaging	0.90
R2176:Cntnap5c	UTSW	17	58013946	missense	probably benign	0.04
R2256:Cntnap5c	UTSW	17	58330315	missense	probably benign	0.00
R2847:Cntnap5c	UTSW	17	57876392	missense	probably damaging	0.99
R2848:Cntnap5c	UTSW	17	57876392	missense	probably damaging	0.99
R2850:Cntnap5c	UTSW	17	58410348	utr 3 prime	probably benign
R3008:Cntnap5c	UTSW	17	58359209	missense	probably damaging	1.00
R3714:Cntnap5c	UTSW	17	57892067	nonsense	probably null
R3720:Cntnap5c	UTSW	17	58330202	missense	probably benign
R3755:Cntnap5c	UTSW	17	58104599	missense	possibly damaging	0.82
R4001:Cntnap5c	UTSW	17	58407740	critical splice donor site	probably null
R4619:Cntnap5c	UTSW	17	58410268	missense	probably benign
R5146:Cntnap5c	UTSW	17	58013847	missense	probably damaging	0.96
R5309:Cntnap5c	UTSW	17	58359254	missense	probably benign	0.05
R5312:Cntnap5c	UTSW	17	58359254	missense	probably benign	0.05
R5722:Cntnap5c	UTSW	17	58313857	missense	probably benign	0.01
R5974:Cntnap5c	UTSW	17	57876485	missense	probably benign	0.00
R6017:Cntnap5c	UTSW	17	58104698	missense	probably benign	0.41
R6059:Cntnap5c	UTSW	17	58313712	missense	probably damaging	0.99
R6152:Cntnap5c	UTSW	17	58286886	missense	possibly damaging	0.65
R6182:Cntnap5c	UTSW	17	57876395	missense	probably benign	0.00
R6298:Cntnap5c	UTSW	17	58104752	missense	probably damaging	1.00
R6301:Cntnap5c	UTSW	17	57892037	missense	probably benign	0.01
R6514:Cntnap5c	UTSW	17	58330170	missense	probably damaging	0.96
R6583:Cntnap5c	UTSW	17	58330277	missense	probably damaging	1.00
R6688:Cntnap5c	UTSW	17	58293904	missense	possibly damaging	0.71
R6781:Cntnap5c	UTSW	17	58138653	nonsense	probably null
R6866:Cntnap5c	UTSW	17	58092294	missense	probably benign
R6906:Cntnap5c	UTSW	17	58395307	missense	probably benign	0.18
R6911:Cntnap5c	UTSW	17	57892014	missense	probably damaging	1.00
R6919:Cntnap5c	UTSW	17	58293953	missense	probably benign	0.02
R6923:Cntnap5c	UTSW	17	58092350	missense	possibly damaging	0.96
R6925:Cntnap5c	UTSW	17	58395266	missense	probably benign	0.39
R6982:Cntnap5c	UTSW	17	58092252	missense	possibly damaging	0.77
R7144:Cntnap5c	UTSW	17	58286888	missense	probably benign
R7422:Cntnap5c	UTSW	17	58410231	nonsense	probably null
R7797:Cntnap5c	UTSW	17	58359275	missense	probably benign	0.11
R7830:Cntnap5c	UTSW	17	58162250	missense	probably damaging	1.00
R8169:Cntnap5c	UTSW	17	58104770	critical splice donor site	probably null
R8351:Cntnap5c	UTSW	17	58055692	missense	probably damaging	1.00
R8352:Cntnap5c	UTSW	17	58055692	missense	probably damaging	1.00
R8451:Cntnap5c	UTSW	17	58055692	missense	probably damaging	1.00
R8452:Cntnap5c	UTSW	17	58055692	missense	probably damaging	1.00
RF010:Cntnap5c	UTSW	17	58286795	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTACAATCACAGTAGCTCAAGGAACC -3'
(R):5'- AGCTGAAATTGGAAATGGCCTTCCTC -3'

Sequencing Primer
(F):5'- CTCCAGACAGGCAGAGATGC -3'
(R):5'- TCAGCCCGGATATAATGCCA -3'

Posted On

2014-01-29