Mutagenetix > Incidental Mutation

Incidental Mutation 'R1081:Dsc2'

152725

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

039167-MU

Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1081 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 20033295 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 760 (T760P)

Ref Sequence

ENSEMBL: ENSMUSP00000074702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

probably damaging
Transcript: ENSMUST00000039247
AA Change: T760P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: T760P

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000075214
AA Change: T760P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: T760P

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000155407
AA Change: T159P

SMART Domains

Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331
AA Change: T159P

Domain	Start	End	E-Value	Type
SCOP:d1l3wa5	2	71	2e-3	SMART
Blast:CA	2	76	2e-47	BLAST
transmembrane domain	96	118	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	A	G	6: 83,162,020	E309G	probably benign	Het
Abr	T	C	11: 76,455,615	K448E	probably damaging	Het
Atxn2l	T	C	7: 126,494,212	Y785C	probably damaging	Het
Atxn3	T	G	12: 101,934,349	D225A	probably damaging	Het
BC049730	T	C	7: 24,713,542		probably null	Het
Cdh15	G	C	8: 122,857,495	E112Q	probably damaging	Het
Cntnap5c	A	G	17: 58,305,525	D853G	possibly damaging	Het
Dnah9	A	G	11: 66,084,877	Y1449H	probably damaging	Het
Dync2h1	A	T	9: 7,005,488		probably null	Het
Epg5	T	C	18: 77,959,533	F611L	possibly damaging	Het
Fat3	T	C	9: 16,375,284	D981G	possibly damaging	Het
Gimap3	A	T	6: 48,765,152	C281*	probably null	Het
Ids	T	C	X: 70,361,110	D149G	possibly damaging	Het
Inpp4b	A	G	8: 82,069,024	I826V	probably damaging	Het
Kcnrg	C	A	14: 61,607,714	H68N	possibly damaging	Het
Klra6	A	G	6: 130,022,625	Y127H	probably damaging	Het
Mepce	A	G	5: 137,784,696	L456P	probably damaging	Het
Mink1	T	C	11: 70,607,035	L488P	probably benign	Het
Mndal	T	A	1: 173,860,222	E482V	probably benign	Het
Mob1b	G	A	5: 88,753,162	V143I	probably benign	Het
Msh4	T	C	3: 153,872,358	E433G	probably benign	Het
Myof	A	T	19: 37,986,088	I201N	probably damaging	Het
Naip1	G	A	13: 100,423,070	S1142F	probably benign	Het
Ntsr1	G	A	2: 180,538,756	S285N	probably benign	Het
Olfr319	C	T	11: 58,702,498	H266Y	probably damaging	Het
Olfr598	A	G	7: 103,329,038	Y184C	probably damaging	Het
Olfr66	T	A	7: 103,882,177	H22L	possibly damaging	Het
Olfr730	A	G	14: 50,187,197	S7P	probably damaging	Het
P2rx4	A	G	5: 122,727,233	E307G	probably damaging	Het
Pcdh15	A	G	10: 74,450,313	D793G	probably damaging	Het
Rpap1	G	A	2: 119,771,269	R737W	probably damaging	Het
Rpusd4	A	G	9: 35,275,088	K307E	probably benign	Het
Shtn1	T	A	19: 58,975,015	T623S	probably benign	Het
Sntg1	A	G	1: 8,445,119	C397R	possibly damaging	Het
Stat5a	T	C	11: 100,881,060	F646S	probably damaging	Het
Tacc2	A	G	7: 130,728,574	E196G	possibly damaging	Het
Tcf25	T	C	8: 123,381,473	V89A	probably benign	Het
Trim7	G	T	11: 48,849,705	V210L	probably damaging	Het
Vmn2r57	A	G	7: 41,428,211	M177T	possibly damaging	Het
Wwc2	G	A	8: 47,828,764		probably benign	Het
Zfp28	A	G	7: 6,389,780	I152V	possibly damaging	Het
Zfp628	A	G	7: 4,920,183	H468R	probably damaging	Het
Zfp770	A	G	2: 114,197,127	Y154H	probably damaging	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
R9487:Dsc2	UTSW	18	20047219	missense	probably damaging	0.99
R9663:Dsc2	UTSW	18	20038148	missense	probably damaging	1.00
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCGGGGCTGAATGAAATTGTACCAC -3'
(R):5'- TGCACAGCATTGCTGCTTTTGAG -3'

Sequencing Primer
(F):5'- ACCACTCTGAGTAAGTGTGTC -3'
(R):5'- CACATGCAGTATGTTAAGGAGTC -3'

Posted On

2014-01-29