Mutagenetix > Incidental Mutation

Incidental Mutation 'R1081:Myof'

152727

Institutional Source

Beutler Lab

Gene Symbol

Myof

Ensembl Gene

ENSMUSG00000048612

Gene Name

myoferlin

Synonyms

Fer1l3, E030042N20Rik, 2310051D19Rik

MMRRC Submission

039167-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1081 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37899036-38043577 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 37986088 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 201 (I201N)

Ref Sequence

ENSEMBL: ENSMUSP00000045036 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041475] [ENSMUST00000172095] [ENSMUST00000226068]

AlphaFold

Q69ZN7

Predicted Effect

probably damaging
Transcript: ENSMUST00000041475
AA Change: I201N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000045036
Gene: ENSMUSG00000048612
AA Change: I201N

Domain	Start	End	E-Value	Type
C2	1	100	7.56e-16	SMART
low complexity region	142	159	N/A	INTRINSIC
C2	200	299	4.03e-11	SMART
FerI	282	353	2.76e-37	SMART
C2	359	473	2.93e-13	SMART
low complexity region	532	543	N/A	INTRINSIC
FerA	663	728	5.07e-27	SMART
FerB	755	829	2.39e-46	SMART
DysFN	843	901	6.42e-21	SMART
DysFN	914	970	1.16e-18	SMART
DysFC	979	1017	1.04e-11	SMART
DysFC	1037	1070	1.62e-8	SMART
C2	1127	1234	5.03e-12	SMART
C2	1289	1396	1.15e1	SMART
low complexity region	1425	1436	N/A	INTRINSIC
low complexity region	1515	1526	N/A	INTRINSIC
C2	1541	1640	2.66e-11	SMART
C2	1776	1905	2.81e-1	SMART
Pfam:Ferlin_C	1939	2043	2.4e-29	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172095
AA Change: I201N

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000129792
Gene: ENSMUSG00000048612
AA Change: I201N

Domain	Start	End	E-Value	Type
C2	1	100	7.56e-16	SMART
low complexity region	142	159	N/A	INTRINSIC
C2	200	299	4.03e-11	SMART
FerI	282	353	2.76e-37	SMART
C2	359	473	2.93e-13	SMART
low complexity region	532	543	N/A	INTRINSIC
FerA	663	728	5.07e-27	SMART
FerB	755	829	2.39e-46	SMART
DysFN	843	901	6.42e-21	SMART
DysFN	914	970	1.16e-18	SMART
DysFC	979	1017	1.04e-11	SMART
DysFC	1037	1070	1.62e-8	SMART
C2	1127	1234	5.03e-12	SMART
C2	1289	1396	1.15e1	SMART
low complexity region	1515	1526	N/A	INTRINSIC
C2	1541	1640	2.66e-11	SMART
C2	1776	1905	2.81e-1	SMART
transmembrane domain	2013	2035	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223650

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226068
AA Change: I201N

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226084

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.8%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the ferlin family of proteins, which have been implicated in fusion events in muscle tissue. Members of this family have a carboxy-terminal single pass transmembrane domain and multiple C2 domains, which bind negatively charged phospholipids in the presence of calcium ions. This gene is expressed at high levels in myoblasts and upregulated in damaged skeletal muscle. Mice deficient in this protein display defects in myoblast fusion, muscle regeneration, and angiogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, impaired myogenesis, lack of large diameter myofibers, abnormal skeletal muscle regeneration after injury, and decreased vascular permeability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	A	G	6: 83,162,020	E309G	probably benign	Het
Abr	T	C	11: 76,455,615	K448E	probably damaging	Het
Atxn2l	T	C	7: 126,494,212	Y785C	probably damaging	Het
Atxn3	T	G	12: 101,934,349	D225A	probably damaging	Het
BC049730	T	C	7: 24,713,542		probably null	Het
Cdh15	G	C	8: 122,857,495	E112Q	probably damaging	Het
Cntnap5c	A	G	17: 58,305,525	D853G	possibly damaging	Het
Dnah9	A	G	11: 66,084,877	Y1449H	probably damaging	Het
Dsc2	T	G	18: 20,033,295	T760P	probably damaging	Het
Dync2h1	A	T	9: 7,005,488		probably null	Het
Epg5	T	C	18: 77,959,533	F611L	possibly damaging	Het
Fat3	T	C	9: 16,375,284	D981G	possibly damaging	Het
Gimap3	A	T	6: 48,765,152	C281*	probably null	Het
Ids	T	C	X: 70,361,110	D149G	possibly damaging	Het
Inpp4b	A	G	8: 82,069,024	I826V	probably damaging	Het
Kcnrg	C	A	14: 61,607,714	H68N	possibly damaging	Het
Klra6	A	G	6: 130,022,625	Y127H	probably damaging	Het
Mepce	A	G	5: 137,784,696	L456P	probably damaging	Het
Mink1	T	C	11: 70,607,035	L488P	probably benign	Het
Mndal	T	A	1: 173,860,222	E482V	probably benign	Het
Mob1b	G	A	5: 88,753,162	V143I	probably benign	Het
Msh4	T	C	3: 153,872,358	E433G	probably benign	Het
Naip1	G	A	13: 100,423,070	S1142F	probably benign	Het
Ntsr1	G	A	2: 180,538,756	S285N	probably benign	Het
Olfr319	C	T	11: 58,702,498	H266Y	probably damaging	Het
Olfr598	A	G	7: 103,329,038	Y184C	probably damaging	Het
Olfr66	T	A	7: 103,882,177	H22L	possibly damaging	Het
Olfr730	A	G	14: 50,187,197	S7P	probably damaging	Het
P2rx4	A	G	5: 122,727,233	E307G	probably damaging	Het
Pcdh15	A	G	10: 74,450,313	D793G	probably damaging	Het
Rpap1	G	A	2: 119,771,269	R737W	probably damaging	Het
Rpusd4	A	G	9: 35,275,088	K307E	probably benign	Het
Shtn1	T	A	19: 58,975,015	T623S	probably benign	Het
Sntg1	A	G	1: 8,445,119	C397R	possibly damaging	Het
Stat5a	T	C	11: 100,881,060	F646S	probably damaging	Het
Tacc2	A	G	7: 130,728,574	E196G	possibly damaging	Het
Tcf25	T	C	8: 123,381,473	V89A	probably benign	Het
Trim7	G	T	11: 48,849,705	V210L	probably damaging	Het
Vmn2r57	A	G	7: 41,428,211	M177T	possibly damaging	Het
Wwc2	G	A	8: 47,828,764		probably benign	Het
Zfp28	A	G	7: 6,389,780	I152V	possibly damaging	Het
Zfp628	A	G	7: 4,920,183	H468R	probably damaging	Het
Zfp770	A	G	2: 114,197,127	Y154H	probably damaging	Het

Other mutations in Myof

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Myof	APN	19	37960934	missense	probably benign	0.16
IGL00764:Myof	APN	19	37974923	missense	probably benign	0.04
IGL00801:Myof	APN	19	37986073	missense	probably damaging	0.99
IGL01084:Myof	APN	19	37936436	missense	probably damaging	1.00
IGL01368:Myof	APN	19	37936457	missense	probably damaging	0.97
IGL01472:Myof	APN	19	37923076	missense	probably benign
IGL01785:Myof	APN	19	37980423	nonsense	probably null
IGL02205:Myof	APN	19	37924635	missense	probably damaging	1.00
IGL02268:Myof	APN	19	37954429	missense	possibly damaging	0.50
IGL02268:Myof	APN	19	37974863	missense	possibly damaging	0.90
IGL02339:Myof	APN	19	37972213	missense	possibly damaging	0.46
IGL02433:Myof	APN	19	37972193	missense	probably benign	0.05
IGL02481:Myof	APN	19	37937913	nonsense	probably null
IGL02536:Myof	APN	19	37949655	missense	probably damaging	0.97
IGL02682:Myof	APN	19	37921481	missense	probably benign	0.09
IGL02732:Myof	APN	19	37977716	missense	possibly damaging	0.50
IGL02887:Myof	APN	19	37920779	critical splice acceptor site	probably null
IGL03114:Myof	APN	19	37903861	missense	probably damaging	1.00
IGL03137:Myof	APN	19	37974889	missense	probably damaging	1.00
IGL03340:Myof	APN	19	37911159	missense	probably damaging	1.00
PIT4791001:Myof	UTSW	19	37982958	critical splice donor site	probably null
R0024:Myof	UTSW	19	37915740	missense	probably damaging	0.98
R0140:Myof	UTSW	19	37951556	nonsense	probably null
R0309:Myof	UTSW	19	37981266	missense	probably benign	0.12
R0330:Myof	UTSW	19	37935878	missense	probably damaging	1.00
R0345:Myof	UTSW	19	38024345	missense	probably damaging	1.00
R0349:Myof	UTSW	19	37910969	missense	probably damaging	0.99
R0463:Myof	UTSW	19	37916504	missense	probably damaging	1.00
R0507:Myof	UTSW	19	37901277	missense	possibly damaging	0.94
R0512:Myof	UTSW	19	37954524	missense	possibly damaging	0.54
R0608:Myof	UTSW	19	37916504	missense	probably damaging	1.00
R0723:Myof	UTSW	19	37981260	missense	probably damaging	1.00
R1196:Myof	UTSW	19	37910960	missense	probably damaging	1.00
R1243:Myof	UTSW	19	37936092	missense	probably damaging	1.00
R1371:Myof	UTSW	19	37903668	splice site	probably benign
R1381:Myof	UTSW	19	37995485	missense	probably damaging	1.00
R1419:Myof	UTSW	19	37901911	missense	probably damaging	1.00
R1527:Myof	UTSW	19	37924619	missense	probably damaging	1.00
R1672:Myof	UTSW	19	37943479	missense	probably damaging	1.00
R1864:Myof	UTSW	19	37986705	missense	probably benign
R1914:Myof	UTSW	19	37977693	missense	probably damaging	1.00
R1915:Myof	UTSW	19	37977693	missense	probably damaging	1.00
R1970:Myof	UTSW	19	37945634	missense	probably damaging	0.99
R2062:Myof	UTSW	19	37915746	missense	possibly damaging	0.94
R2144:Myof	UTSW	19	37981221	critical splice donor site	probably null
R2243:Myof	UTSW	19	37901319	missense	probably damaging	1.00
R2339:Myof	UTSW	19	37937927	missense	probably damaging	1.00
R2484:Myof	UTSW	19	37903843	missense	probably benign	0.13
R2880:Myof	UTSW	19	37923025	missense	probably benign	0.04
R3418:Myof	UTSW	19	37922978	missense	probably damaging	0.97
R3967:Myof	UTSW	19	37901263	missense	probably damaging	1.00
R3967:Myof	UTSW	19	38022610	missense	possibly damaging	0.59
R3970:Myof	UTSW	19	37901263	missense	probably damaging	1.00
R3970:Myof	UTSW	19	38022610	missense	possibly damaging	0.59
R4238:Myof	UTSW	19	37923008	nonsense	probably null
R4405:Myof	UTSW	19	37922978	missense	probably damaging	0.97
R4406:Myof	UTSW	19	37922978	missense	probably damaging	0.97
R4407:Myof	UTSW	19	37922978	missense	probably damaging	0.97
R4408:Myof	UTSW	19	37922978	missense	probably damaging	0.97
R4561:Myof	UTSW	19	37922990	missense	probably benign
R4606:Myof	UTSW	19	37967099	missense	probably damaging	1.00
R4778:Myof	UTSW	19	37949563	missense	probably damaging	1.00
R4801:Myof	UTSW	19	37945738	missense	probably benign	0.24
R4802:Myof	UTSW	19	37945738	missense	probably benign	0.24
R4812:Myof	UTSW	19	37916559	missense	probably damaging	1.00
R4884:Myof	UTSW	19	37942357	missense	probably damaging	1.00
R4964:Myof	UTSW	19	37935852	missense	probably damaging	0.97
R4966:Myof	UTSW	19	37935852	missense	probably damaging	0.97
R5069:Myof	UTSW	19	37905325	missense	possibly damaging	0.65
R5181:Myof	UTSW	19	37932623	missense	possibly damaging	0.95
R5376:Myof	UTSW	19	37916400	missense	probably damaging	1.00
R5384:Myof	UTSW	19	37952987	missense	probably damaging	0.98
R5543:Myof	UTSW	19	37981330	missense	probably benign	0.00
R5626:Myof	UTSW	19	37922990	missense	probably benign
R5865:Myof	UTSW	19	37910934	missense	probably damaging	1.00
R5919:Myof	UTSW	19	38024370	missense	possibly damaging	0.95
R5924:Myof	UTSW	19	37982973	missense	probably damaging	0.97
R5997:Myof	UTSW	19	37905299	missense	possibly damaging	0.90
R5999:Myof	UTSW	19	37939856	nonsense	probably null
R6039:Myof	UTSW	19	37977684	missense	probably damaging	1.00
R6039:Myof	UTSW	19	37977684	missense	probably damaging	1.00
R6041:Myof	UTSW	19	37924620	missense	probably damaging	1.00
R6051:Myof	UTSW	19	38024361	missense	probably damaging	1.00
R6057:Myof	UTSW	19	37926981	critical splice donor site	probably null
R6089:Myof	UTSW	19	37967060	missense	probably benign	0.37
R6195:Myof	UTSW	19	37913357	missense	possibly damaging	0.89
R6478:Myof	UTSW	19	37903831	missense	probably damaging	1.00
R6545:Myof	UTSW	19	37942297	missense	possibly damaging	0.67
R6655:Myof	UTSW	19	37934791	missense	probably damaging	1.00
R6715:Myof	UTSW	19	37968346	missense	probably benign	0.04
R6737:Myof	UTSW	19	37943514	missense	probably benign	0.01
R6837:Myof	UTSW	19	37922956	critical splice donor site	probably null
R7096:Myof	UTSW	19	37936200	missense	probably damaging	1.00
R7308:Myof	UTSW	19	37910911	missense	probably damaging	0.98
R7328:Myof	UTSW	19	37916399	missense	probably damaging	1.00
R7485:Myof	UTSW	19	37951491	nonsense	probably null
R7554:Myof	UTSW	19	37954510	missense	probably benign	0.09
R7759:Myof	UTSW	19	37939898	missense	probably benign	0.00
R7779:Myof	UTSW	19	37939390	missense	probably damaging	1.00
R8116:Myof	UTSW	19	37932719	missense	probably damaging	0.99
R8264:Myof	UTSW	19	37921433	missense	probably damaging	1.00
R8415:Myof	UTSW	19	37995424	missense	probably benign
R8756:Myof	UTSW	19	37939952	missense	probably benign
R8777:Myof	UTSW	19	37980393	missense	probably benign	0.01
R8777-TAIL:Myof	UTSW	19	37980393	missense	probably benign	0.01
R8835:Myof	UTSW	19	37967099	missense	possibly damaging	0.92
R9396:Myof	UTSW	19	37934846	missense	probably damaging	1.00
R9415:Myof	UTSW	19	37952964	missense	probably damaging	1.00
R9450:Myof	UTSW	19	37960926	missense	probably damaging	1.00
R9451:Myof	UTSW	19	37977648	critical splice donor site	probably null
R9537:Myof	UTSW	19	37907606	missense	probably damaging	1.00
R9592:Myof	UTSW	19	38043289	missense	probably damaging	0.99
R9616:Myof	UTSW	19	37934815	missense	possibly damaging	0.52
X0024:Myof	UTSW	19	37974597	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- TCTGTGAACCGGGTGAAATTGGC -3'
(R):5'- GGGACACTTGTAGACCAGGCAATG -3'

Sequencing Primer
(F):5'- CATGTACAAACAGGACAGACTG -3'
(R):5'- CTCAGGGCGGGAATCTTAGTC -3'

Posted On

2014-01-29