Incidental Mutation 'R1081:Ids'
ID152729
Institutional Source Beutler Lab
Gene Symbol Ids
Ensembl Gene ENSMUSG00000035847
Gene Nameiduronate 2-sulfatase
Synonyms
MMRRC Submission 039167-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R1081 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location70343069-70365084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70361110 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 149 (D149G)
Ref Sequence ENSEMBL: ENSMUSP00000099046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101509]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101509
AA Change: D149G

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099046
Gene: ENSMUSG00000035847
AA Change: D149G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Sulfatase 39 418 9.9e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130519
SMART Domains Protein: ENSMUSP00000118732
Gene: ENSMUSG00000035847

DomainStartEndE-ValueType
Pfam:Sulfatase 2 236 7.2e-21 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sulfatase family of proteins. The encoded preproprotein is proteolytically processed to generate two polypeptide chains. This enzyme is involved in the lysosomal degradation of heparan sulfate and dermatan sulfate. Mutations in this gene are associated with the X-linked lysosomal storage disease mucopolysaccharidosis type II, also known as Hunter syndrome. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice with homozygous disruption of this gene display lysosomal accumulation of glycosaminoglycans in multiple tissues, premature death, impaired locomotor activity, joint swelling, and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,020 E309G probably benign Het
Abr T C 11: 76,455,615 K448E probably damaging Het
Atxn2l T C 7: 126,494,212 Y785C probably damaging Het
Atxn3 T G 12: 101,934,349 D225A probably damaging Het
BC049730 T C 7: 24,713,542 probably null Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cntnap5c A G 17: 58,305,525 D853G possibly damaging Het
Dnah9 A G 11: 66,084,877 Y1449H probably damaging Het
Dsc2 T G 18: 20,033,295 T760P probably damaging Het
Dync2h1 A T 9: 7,005,488 probably null Het
Epg5 T C 18: 77,959,533 F611L possibly damaging Het
Fat3 T C 9: 16,375,284 D981G possibly damaging Het
Gimap3 A T 6: 48,765,152 C281* probably null Het
Inpp4b A G 8: 82,069,024 I826V probably damaging Het
Kcnrg C A 14: 61,607,714 H68N possibly damaging Het
Klra6 A G 6: 130,022,625 Y127H probably damaging Het
Mepce A G 5: 137,784,696 L456P probably damaging Het
Mink1 T C 11: 70,607,035 L488P probably benign Het
Mndal T A 1: 173,860,222 E482V probably benign Het
Mob1b G A 5: 88,753,162 V143I probably benign Het
Msh4 T C 3: 153,872,358 E433G probably benign Het
Myof A T 19: 37,986,088 I201N probably damaging Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ntsr1 G A 2: 180,538,756 S285N probably benign Het
Olfr319 C T 11: 58,702,498 H266Y probably damaging Het
Olfr598 A G 7: 103,329,038 Y184C probably damaging Het
Olfr66 T A 7: 103,882,177 H22L possibly damaging Het
Olfr730 A G 14: 50,187,197 S7P probably damaging Het
P2rx4 A G 5: 122,727,233 E307G probably damaging Het
Pcdh15 A G 10: 74,450,313 D793G probably damaging Het
Rpap1 G A 2: 119,771,269 R737W probably damaging Het
Rpusd4 A G 9: 35,275,088 K307E probably benign Het
Shtn1 T A 19: 58,975,015 T623S probably benign Het
Sntg1 A G 1: 8,445,119 C397R possibly damaging Het
Stat5a T C 11: 100,881,060 F646S probably damaging Het
Tacc2 A G 7: 130,728,574 E196G possibly damaging Het
Tcf25 T C 8: 123,381,473 V89A probably benign Het
Trim7 G T 11: 48,849,705 V210L probably damaging Het
Vmn2r57 A G 7: 41,428,211 M177T possibly damaging Het
Wwc2 G A 8: 47,828,764 probably benign Het
Zfp28 A G 7: 6,389,780 I152V possibly damaging Het
Zfp628 A G 7: 4,920,183 H468R probably damaging Het
Zfp770 A G 2: 114,197,127 Y154H probably damaging Het
Other mutations in Ids
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2853:Ids UTSW X 70353170 missense probably damaging 1.00
R4356:Ids UTSW X 70346344 missense probably damaging 0.99
R4357:Ids UTSW X 70346344 missense probably damaging 0.99
R4358:Ids UTSW X 70346344 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTCAGTTGTGCCTCATTAGACTAGC -3'
(R):5'- AGATCGCCCACTTCCAAGGCTTAG -3'

Sequencing Primer
(F):5'- gcaagttccaaaccagcc -3'
(R):5'- ATGGaaacattatctatcttgccg -3'
Posted On2014-01-29