Incidental Mutation 'R1222:Trim45'
ID152743
Institutional Source Beutler Lab
Gene Symbol Trim45
Ensembl Gene ENSMUSG00000033233
Gene Nametripartite motif-containing 45
Synonyms4921530N01Rik
MMRRC Submission 039291-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1222 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location100922202-100936920 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 100927298 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 432 (M432I)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037409] [ENSMUST00000094048] [ENSMUST00000106980] [ENSMUST00000134993]
Predicted Effect probably benign
Transcript: ENSMUST00000037409
AA Change: M432I

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000043389
Gene: ENSMUSG00000033233
AA Change: M432I

DomainStartEndE-ValueType
RING 29 97 5.35e-5 SMART
BBOX 130 176 1.03e-1 SMART
BBOX 186 227 4.34e-5 SMART
BBC 234 360 3.55e-9 SMART
IG_FLMN 398 500 7.63e-33 SMART
low complexity region 532 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094048
AA Change: M383I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000091590
Gene: ENSMUSG00000033233
AA Change: M383I

DomainStartEndE-ValueType
BBOX 81 127 1.03e-1 SMART
BBOX 137 178 4.34e-5 SMART
BBC 185 311 3.55e-9 SMART
IG_FLMN 349 451 7.63e-33 SMART
low complexity region 483 500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106980
AA Change: M432I

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102593
Gene: ENSMUSG00000033233
AA Change: M432I

DomainStartEndE-ValueType
RING 29 97 5.35e-5 SMART
BBOX 130 176 1.03e-1 SMART
BBOX 186 227 4.34e-5 SMART
BBC 234 360 3.55e-9 SMART
IG_FLMN 398 500 7.63e-33 SMART
low complexity region 532 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134993
AA Change: M432I

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000115669
Gene: ENSMUSG00000033233
AA Change: M432I

DomainStartEndE-ValueType
RING 29 97 5.35e-5 SMART
BBOX 130 176 1.03e-1 SMART
BBOX 186 227 4.34e-5 SMART
BBC 234 360 3.55e-9 SMART
IG_FLMN 398 500 7.63e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163914
AA Change: M432I

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129861
Gene: ENSMUSG00000033233
AA Change: M432I

DomainStartEndE-ValueType
RING 29 97 5.35e-5 SMART
BBOX 130 176 1.03e-1 SMART
BBOX 186 227 4.34e-5 SMART
BBC 234 360 3.55e-9 SMART
IG_FLMN 398 500 7.63e-33 SMART
Meta Mutation Damage Score 0.1312 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif family. The encoded protein may function as a transcriptional repressor of the mitogen-activated protein kinase pathway. Alternatively spliced transcript variants have been described.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,145,064 probably benign Het
Abl1 T C 2: 31,800,994 S842P probably benign Het
Agrn C A 4: 156,177,385 V483L probably damaging Het
Ankrd13a T A 5: 114,800,763 C365* probably null Het
Ap2b1 T C 11: 83,346,738 S543P probably benign Het
Atic C T 1: 71,559,279 T67I probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cux1 C T 5: 136,275,149 R1391Q probably benign Het
Cyp2a4 T C 7: 26,308,588 V140A possibly damaging Het
Dlgap3 A T 4: 127,194,613 M1L probably null Het
Dnah3 T C 7: 120,090,676 D2G probably benign Het
Erbb3 A C 10: 128,571,665 V938G probably damaging Het
Fam13a C T 6: 58,935,722 probably benign Het
Gata2 G A 6: 88,200,341 V118I probably benign Het
Gm2663 T C 6: 40,996,041 I211V probably benign Het
Gm5096 A G 18: 87,757,334 K327R probably damaging Het
Gm8298 T A 3: 59,877,261 L385* probably null Het
Izumo3 T A 4: 92,145,047 N104I probably damaging Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Mctp2 T A 7: 72,259,139 H142L probably benign Het
Mmp10 T C 9: 7,505,681 probably benign Het
Mroh8 G A 2: 157,241,854 probably benign Het
Mylk T C 16: 34,860,652 V94A probably benign Het
Nol6 A T 4: 41,120,760 N396K probably benign Het
Nr4a2 A T 2: 57,108,324 N543K probably damaging Het
Nynrin T C 14: 55,863,541 S263P probably benign Het
Olfr1115 G T 2: 87,252,422 G162C probably benign Het
Olfr395 A T 11: 73,907,414 L26H probably damaging Het
Olfr493 T A 7: 108,346,106 I292F probably damaging Het
Olfr77 G A 9: 19,921,048 V280I possibly damaging Het
Pkhd1 T A 1: 20,567,456 R368S probably benign Het
Plekhg4 G A 8: 105,379,110 A736T probably benign Het
Plxna2 A G 1: 194,800,649 D1550G probably damaging Het
Qrfpr C A 3: 36,180,095 G366W probably damaging Het
Qser1 C A 2: 104,777,431 A1471S probably damaging Het
Rars A T 11: 35,809,740 Y505N probably damaging Het
Reln T A 5: 21,986,955 T1496S probably null Het
Rrs1 T C 1: 9,545,855 L111P probably benign Het
Selplg C T 5: 113,819,373 V291M possibly damaging Het
Serpinb1c T A 13: 32,896,951 T50S possibly damaging Het
Slc4a5 A G 6: 83,280,132 K640E probably damaging Het
Szt2 A T 4: 118,405,459 H40Q possibly damaging Het
Taar4 C T 10: 23,961,332 T280I probably benign Het
Tdo2 A G 3: 81,961,468 probably null Het
Tpp1 T C 7: 105,746,741 N527S probably benign Het
Trim43c A T 9: 88,843,078 T218S possibly damaging Het
Ubr4 T C 4: 139,388,471 probably null Het
Vat1l T C 8: 114,282,361 probably benign Het
Xpo7 A T 14: 70,667,084 H1037Q possibly damaging Het
Zmiz1 T C 14: 25,658,096 probably benign Het
Other mutations in Trim45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Trim45 APN 3 100931726 intron probably benign
IGL01472:Trim45 APN 3 100928065 missense probably benign 0.00
IGL01996:Trim45 APN 3 100928109 nonsense probably null 0.00
IGL02392:Trim45 APN 3 100925305 missense probably benign 0.04
IGL03229:Trim45 APN 3 100923069 missense probably damaging 1.00
IGL02837:Trim45 UTSW 3 100931627 intron probably benign
R0021:Trim45 UTSW 3 100925420 missense probably damaging 1.00
R0243:Trim45 UTSW 3 100929844 missense probably benign 0.05
R0501:Trim45 UTSW 3 100923219 missense probably damaging 1.00
R1418:Trim45 UTSW 3 100927298 missense probably benign 0.14
R1813:Trim45 UTSW 3 100922967 missense probably benign 0.16
R2148:Trim45 UTSW 3 100932044 nonsense probably null
R2383:Trim45 UTSW 3 100925227 missense probably damaging 0.97
R4368:Trim45 UTSW 3 100923186 missense probably damaging 1.00
R4769:Trim45 UTSW 3 100931734 intron probably benign
R4840:Trim45 UTSW 3 100925488 missense possibly damaging 0.95
R5030:Trim45 UTSW 3 100928072 missense probably damaging 1.00
R5272:Trim45 UTSW 3 100929919 missense probably damaging 1.00
R5298:Trim45 UTSW 3 100925471 missense probably damaging 1.00
R5498:Trim45 UTSW 3 100925141 missense possibly damaging 0.67
R5589:Trim45 UTSW 3 100929941 missense probably damaging 1.00
R6537:Trim45 UTSW 3 100925396 missense probably benign 0.39
R6850:Trim45 UTSW 3 100923225 nonsense probably null
R7009:Trim45 UTSW 3 100931879 intron probably benign
R7122:Trim45 UTSW 3 100932037 missense unknown
R7583:Trim45 UTSW 3 100925023 missense probably damaging 1.00
X0066:Trim45 UTSW 3 100931767 intron probably benign
Z1088:Trim45 UTSW 3 100925640 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCTCACAACAGGGAAGTTGCAAGC -3'
(R):5'- CCTGGTGTCATGGAACCTCACAATG -3'

Sequencing Primer
(F):5'- AGTTCTATGTGATCCCAGAGCAG -3'
(R):5'- ATGAAAGAGTCCATCTATATCTCCC -3'
Posted On2014-01-29