Incidental Mutation 'R1222:Dlgap3'
ID152748
Institutional Source Beutler Lab
Gene Symbol Dlgap3
Ensembl Gene ENSMUSG00000042388
Gene NameDLG associated protein 3
SynonymsPSD-95/SAP90-binding protein 3, SAP90/PSD 95 associated protein 3, Sapap3, DAP3, Prpl8
MMRRC Submission 039291-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R1222 (G1)
Quality Score114
Status Validated
Chromosome4
Chromosomal Location127169204-127237022 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 127194613 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000101698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046659] [ENSMUST00000106092] [ENSMUST00000106092] [ENSMUST00000106094]
Predicted Effect probably benign
Transcript: ENSMUST00000046659
AA Change: M1L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000039724
Gene: ENSMUSG00000042388
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 53 88 N/A INTRINSIC
low complexity region 145 159 N/A INTRINSIC
low complexity region 200 243 N/A INTRINSIC
low complexity region 258 284 N/A INTRINSIC
low complexity region 338 354 N/A INTRINSIC
internal_repeat_1 387 411 6.49e-5 PROSPERO
low complexity region 419 429 N/A INTRINSIC
internal_repeat_1 493 517 6.49e-5 PROSPERO
low complexity region 539 550 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Pfam:GKAP 619 977 1.3e-137 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106092
AA Change: M1L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000101698
Gene: ENSMUSG00000042388
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 53 88 N/A INTRINSIC
low complexity region 145 159 N/A INTRINSIC
low complexity region 200 243 N/A INTRINSIC
low complexity region 258 284 N/A INTRINSIC
low complexity region 338 354 N/A INTRINSIC
internal_repeat_1 387 411 5.59e-5 PROSPERO
low complexity region 419 429 N/A INTRINSIC
internal_repeat_1 493 517 5.59e-5 PROSPERO
low complexity region 539 550 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Pfam:GKAP 619 966 1.8e-127 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106092
AA Change: M1L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000101698
Gene: ENSMUSG00000042388
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 53 88 N/A INTRINSIC
low complexity region 145 159 N/A INTRINSIC
low complexity region 200 243 N/A INTRINSIC
low complexity region 258 284 N/A INTRINSIC
low complexity region 338 354 N/A INTRINSIC
internal_repeat_1 387 411 5.59e-5 PROSPERO
low complexity region 419 429 N/A INTRINSIC
internal_repeat_1 493 517 5.59e-5 PROSPERO
low complexity region 539 550 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Pfam:GKAP 619 966 1.8e-127 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106094
AA Change: M1L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101700
Gene: ENSMUSG00000042388
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 53 88 N/A INTRINSIC
low complexity region 145 159 N/A INTRINSIC
low complexity region 200 243 N/A INTRINSIC
low complexity region 258 284 N/A INTRINSIC
low complexity region 338 354 N/A INTRINSIC
internal_repeat_1 387 411 6.49e-5 PROSPERO
low complexity region 419 429 N/A INTRINSIC
internal_repeat_1 493 517 6.49e-5 PROSPERO
low complexity region 539 550 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Pfam:GKAP 626 977 1.3e-149 PFAM
Meta Mutation Damage Score 0.8829 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 96% (54/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit skin lesions associated with excessive grooming, increased anxiety-related behaviors, altered synaptic transmission and abnormal sleep patterns. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,145,064 probably benign Het
Abl1 T C 2: 31,800,994 S842P probably benign Het
Agrn C A 4: 156,177,385 V483L probably damaging Het
Ankrd13a T A 5: 114,800,763 C365* probably null Het
Ap2b1 T C 11: 83,346,738 S543P probably benign Het
Atic C T 1: 71,559,279 T67I probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cux1 C T 5: 136,275,149 R1391Q probably benign Het
Cyp2a4 T C 7: 26,308,588 V140A possibly damaging Het
Dnah3 T C 7: 120,090,676 D2G probably benign Het
Erbb3 A C 10: 128,571,665 V938G probably damaging Het
Fam13a C T 6: 58,935,722 probably benign Het
Gata2 G A 6: 88,200,341 V118I probably benign Het
Gm2663 T C 6: 40,996,041 I211V probably benign Het
Gm5096 A G 18: 87,757,334 K327R probably damaging Het
Gm8298 T A 3: 59,877,261 L385* probably null Het
Izumo3 T A 4: 92,145,047 N104I probably damaging Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Mctp2 T A 7: 72,259,139 H142L probably benign Het
Mmp10 T C 9: 7,505,681 probably benign Het
Mroh8 G A 2: 157,241,854 probably benign Het
Mylk T C 16: 34,860,652 V94A probably benign Het
Nol6 A T 4: 41,120,760 N396K probably benign Het
Nr4a2 A T 2: 57,108,324 N543K probably damaging Het
Nynrin T C 14: 55,863,541 S263P probably benign Het
Olfr1115 G T 2: 87,252,422 G162C probably benign Het
Olfr395 A T 11: 73,907,414 L26H probably damaging Het
Olfr493 T A 7: 108,346,106 I292F probably damaging Het
Olfr77 G A 9: 19,921,048 V280I possibly damaging Het
Pkhd1 T A 1: 20,567,456 R368S probably benign Het
Plekhg4 G A 8: 105,379,110 A736T probably benign Het
Plxna2 A G 1: 194,800,649 D1550G probably damaging Het
Qrfpr C A 3: 36,180,095 G366W probably damaging Het
Qser1 C A 2: 104,777,431 A1471S probably damaging Het
Rars A T 11: 35,809,740 Y505N probably damaging Het
Reln T A 5: 21,986,955 T1496S probably null Het
Rrs1 T C 1: 9,545,855 L111P probably benign Het
Selplg C T 5: 113,819,373 V291M possibly damaging Het
Serpinb1c T A 13: 32,896,951 T50S possibly damaging Het
Slc4a5 A G 6: 83,280,132 K640E probably damaging Het
Szt2 A T 4: 118,405,459 H40Q possibly damaging Het
Taar4 C T 10: 23,961,332 T280I probably benign Het
Tdo2 A G 3: 81,961,468 probably null Het
Tpp1 T C 7: 105,746,741 N527S probably benign Het
Trim43c A T 9: 88,843,078 T218S possibly damaging Het
Trim45 G T 3: 100,927,298 M432I probably benign Het
Ubr4 T C 4: 139,388,471 probably null Het
Vat1l T C 8: 114,282,361 probably benign Het
Xpo7 A T 14: 70,667,084 H1037Q possibly damaging Het
Zmiz1 T C 14: 25,658,096 probably benign Het
Other mutations in Dlgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Dlgap3 APN 4 127233897 missense probably benign 0.01
IGL03122:Dlgap3 APN 4 127195225 missense possibly damaging 0.86
IGL03259:Dlgap3 APN 4 127200284 missense probably benign 0.05
Compulsive UTSW 4 127195709 nonsense probably null
R0363:Dlgap3 UTSW 4 127235521 missense probably damaging 1.00
R1386:Dlgap3 UTSW 4 127194926 missense possibly damaging 0.81
R1603:Dlgap3 UTSW 4 127195228 missense probably damaging 1.00
R2073:Dlgap3 UTSW 4 127195366 missense probably damaging 0.99
R2119:Dlgap3 UTSW 4 127236189 missense probably benign
R2696:Dlgap3 UTSW 4 127194623 missense probably damaging 1.00
R3076:Dlgap3 UTSW 4 127195706 missense probably damaging 1.00
R3738:Dlgap3 UTSW 4 127195606 missense probably damaging 0.99
R4344:Dlgap3 UTSW 4 127214348 missense possibly damaging 0.84
R4676:Dlgap3 UTSW 4 127233761 missense probably damaging 0.99
R4720:Dlgap3 UTSW 4 127195715 critical splice donor site probably null
R4893:Dlgap3 UTSW 4 127194983 missense probably damaging 1.00
R5384:Dlgap3 UTSW 4 127236330 missense probably damaging 1.00
R5841:Dlgap3 UTSW 4 127195400 missense probably damaging 1.00
R5870:Dlgap3 UTSW 4 127195709 nonsense probably null
R6379:Dlgap3 UTSW 4 127234974 missense probably damaging 1.00
R7028:Dlgap3 UTSW 4 127195517 missense possibly damaging 0.74
R7454:Dlgap3 UTSW 4 127235059 missense probably null 0.01
R7479:Dlgap3 UTSW 4 127194625 missense possibly damaging 0.72
R8104:Dlgap3 UTSW 4 127236154 missense probably damaging 0.99
X0024:Dlgap3 UTSW 4 127236172 missense probably damaging 1.00
Z1177:Dlgap3 UTSW 4 127194984 missense probably damaging 0.99
Z1177:Dlgap3 UTSW 4 127235498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTGAAAGCATTTCCTCTTGTGG -3'
(R):5'- TTTTCAAACTGGTCCAGGAGTGTGG -3'

Sequencing Primer
(F):5'- AATGATGGGATGATCCTGTGCC -3'
(R):5'- TGATGATGGACCCTCACTCAG -3'
Posted On2014-01-29