Incidental Mutation 'R1222:Reln'
ID 152751
Institutional Source Beutler Lab
Gene Symbol Reln
Ensembl Gene ENSMUSG00000042453
Gene Name reelin
Synonyms
MMRRC Submission 039291-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R1222 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 22089452-22549700 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 22191953 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 1496 (T1496S)
Ref Sequence ENSEMBL: ENSMUSP00000124052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000062372
AA Change: T1496S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: T1496S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 40 172 6.1e-24 PFAM
internal_repeat_3 195 360 5.04e-6 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3450 3457 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161353
Predicted Effect probably null
Transcript: ENSMUST00000161356
AA Change: T1496S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: T1496S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 54 171 2.9e-10 PFAM
internal_repeat_3 195 360 5.06e-6 PROSPERO
internal_repeat_2 207 413 3.41e-11 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
internal_repeat_2 1452 1660 3.41e-11 PROSPERO
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3452 3459 N/A INTRINSIC
Meta Mutation Damage Score 0.2545 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm3 T A 3: 59,784,682 (GRCm39) L385* probably null Het
Abca9 T C 11: 110,035,890 (GRCm39) probably benign Het
Abl1 T C 2: 31,691,006 (GRCm39) S842P probably benign Het
Agrn C A 4: 156,261,842 (GRCm39) V483L probably damaging Het
Ankrd13a T A 5: 114,938,824 (GRCm39) C365* probably null Het
Ap2b1 T C 11: 83,237,564 (GRCm39) S543P probably benign Het
Atic C T 1: 71,598,438 (GRCm39) T67I probably damaging Het
Bhmt1b A G 18: 87,775,458 (GRCm39) K327R probably damaging Het
Car9 G T 4: 43,512,439 (GRCm39) probably null Het
Cux1 C T 5: 136,304,003 (GRCm39) R1391Q probably benign Het
Cyp2a4 T C 7: 26,008,013 (GRCm39) V140A possibly damaging Het
Dlgap3 A T 4: 127,088,406 (GRCm39) M1L probably null Het
Dnah3 T C 7: 119,689,899 (GRCm39) D2G probably benign Het
Erbb3 A C 10: 128,407,534 (GRCm39) V938G probably damaging Het
Fam13a C T 6: 58,912,707 (GRCm39) probably benign Het
Gata2 G A 6: 88,177,323 (GRCm39) V118I probably benign Het
Gm2663 T C 6: 40,972,975 (GRCm39) I211V probably benign Het
Izumo3 T A 4: 92,033,284 (GRCm39) N104I probably damaging Het
Kifc1 G A 17: 34,103,685 (GRCm39) R195C probably benign Het
Mctp2 T A 7: 71,908,887 (GRCm39) H142L probably benign Het
Mmp10 T C 9: 7,505,682 (GRCm39) probably benign Het
Mroh8 G A 2: 157,083,774 (GRCm39) probably benign Het
Mylk T C 16: 34,681,022 (GRCm39) V94A probably benign Het
Nol6 A T 4: 41,120,760 (GRCm39) N396K probably benign Het
Nr4a2 A T 2: 56,998,336 (GRCm39) N543K probably damaging Het
Nynrin T C 14: 56,100,998 (GRCm39) S263P probably benign Het
Or10ag53 G T 2: 87,082,766 (GRCm39) G162C probably benign Het
Or1e35 A T 11: 73,798,240 (GRCm39) L26H probably damaging Het
Or5p68 T A 7: 107,945,313 (GRCm39) I292F probably damaging Het
Or7d10 G A 9: 19,832,344 (GRCm39) V280I possibly damaging Het
Pkhd1 T A 1: 20,637,680 (GRCm39) R368S probably benign Het
Plekhg4 G A 8: 106,105,742 (GRCm39) A736T probably benign Het
Plxna2 A G 1: 194,482,957 (GRCm39) D1550G probably damaging Het
Qrfpr C A 3: 36,234,244 (GRCm39) G366W probably damaging Het
Qser1 C A 2: 104,607,776 (GRCm39) A1471S probably damaging Het
Rars1 A T 11: 35,700,567 (GRCm39) Y505N probably damaging Het
Rrs1 T C 1: 9,616,080 (GRCm39) L111P probably benign Het
Selplg C T 5: 113,957,434 (GRCm39) V291M possibly damaging Het
Serpinb1c T A 13: 33,080,934 (GRCm39) T50S possibly damaging Het
Slc4a5 A G 6: 83,257,114 (GRCm39) K640E probably damaging Het
Szt2 A T 4: 118,262,656 (GRCm39) H40Q possibly damaging Het
Taar4 C T 10: 23,837,230 (GRCm39) T280I probably benign Het
Tdo2 A G 3: 81,868,775 (GRCm39) probably null Het
Tpp1 T C 7: 105,395,948 (GRCm39) N527S probably benign Het
Trim43c A T 9: 88,725,131 (GRCm39) T218S possibly damaging Het
Trim45 G T 3: 100,834,614 (GRCm39) M432I probably benign Het
Ubr4 T C 4: 139,115,782 (GRCm39) probably null Het
Vat1l T C 8: 115,009,101 (GRCm39) probably benign Het
Xpo7 A T 14: 70,904,524 (GRCm39) H1037Q possibly damaging Het
Zmiz1 T C 14: 25,658,520 (GRCm39) probably benign Het
Other mutations in Reln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Reln APN 5 22,244,563 (GRCm39) missense possibly damaging 0.57
IGL00091:Reln APN 5 22,244,563 (GRCm39) missense possibly damaging 0.57
IGL00432:Reln APN 5 22,215,125 (GRCm39) missense probably damaging 1.00
IGL00433:Reln APN 5 22,250,007 (GRCm39) missense probably damaging 1.00
IGL00576:Reln APN 5 22,359,948 (GRCm39) missense probably benign 0.01
IGL00755:Reln APN 5 22,265,378 (GRCm39) missense probably damaging 0.98
IGL00777:Reln APN 5 22,223,848 (GRCm39) critical splice donor site probably null
IGL00900:Reln APN 5 22,185,115 (GRCm39) missense probably damaging 0.98
IGL01067:Reln APN 5 22,184,664 (GRCm39) missense probably damaging 1.00
IGL01104:Reln APN 5 22,191,965 (GRCm39) missense probably damaging 0.99
IGL01141:Reln APN 5 22,174,031 (GRCm39) missense probably damaging 1.00
IGL01141:Reln APN 5 22,124,067 (GRCm39) missense probably damaging 1.00
IGL01333:Reln APN 5 22,376,249 (GRCm39) missense probably damaging 0.99
IGL01341:Reln APN 5 22,174,077 (GRCm39) missense probably damaging 1.00
IGL01354:Reln APN 5 22,124,173 (GRCm39) nonsense probably null
IGL01361:Reln APN 5 22,124,019 (GRCm39) missense probably benign 0.06
IGL01446:Reln APN 5 22,174,315 (GRCm39) missense probably damaging 0.99
IGL01448:Reln APN 5 22,245,403 (GRCm39) missense probably benign 0.40
IGL01612:Reln APN 5 22,101,928 (GRCm39) missense probably damaging 0.99
IGL01695:Reln APN 5 22,125,436 (GRCm39) missense probably damaging 1.00
IGL01718:Reln APN 5 22,152,512 (GRCm39) missense possibly damaging 0.60
IGL01749:Reln APN 5 22,549,244 (GRCm39) nonsense probably null
IGL01875:Reln APN 5 22,109,715 (GRCm39) missense probably benign
IGL02013:Reln APN 5 22,155,877 (GRCm39) missense probably damaging 1.00
IGL02031:Reln APN 5 22,184,014 (GRCm39) missense probably damaging 0.99
IGL02186:Reln APN 5 22,114,956 (GRCm39) missense probably damaging 1.00
IGL02228:Reln APN 5 22,109,729 (GRCm39) missense probably damaging 0.99
IGL02248:Reln APN 5 22,115,990 (GRCm39) missense probably damaging 1.00
IGL02336:Reln APN 5 22,134,132 (GRCm39) missense probably damaging 1.00
IGL02352:Reln APN 5 22,244,563 (GRCm39) missense possibly damaging 0.57
IGL02359:Reln APN 5 22,244,563 (GRCm39) missense possibly damaging 0.57
IGL02376:Reln APN 5 22,285,789 (GRCm39) nonsense probably null
IGL02408:Reln APN 5 22,106,617 (GRCm39) missense probably benign 0.44
IGL02415:Reln APN 5 22,176,949 (GRCm39) missense possibly damaging 0.91
IGL02512:Reln APN 5 22,245,425 (GRCm39) missense probably benign 0.00
IGL02540:Reln APN 5 22,239,750 (GRCm39) missense probably damaging 0.96
IGL02624:Reln APN 5 22,308,355 (GRCm39) missense probably benign 0.09
IGL02720:Reln APN 5 22,202,939 (GRCm39) missense probably damaging 0.99
IGL02894:Reln APN 5 22,090,546 (GRCm39) missense possibly damaging 0.72
IGL02999:Reln APN 5 22,200,363 (GRCm39) missense probably damaging 1.00
IGL03125:Reln APN 5 22,115,842 (GRCm39) missense probably damaging 1.00
IGL03298:Reln APN 5 22,115,834 (GRCm39) missense probably damaging 0.99
Fishing UTSW 5 22,101,839 (GRCm39) missense probably damaging 1.00
P0020:Reln UTSW 5 22,311,058 (GRCm39) missense possibly damaging 0.91
PIT4151001:Reln UTSW 5 22,491,894 (GRCm39) missense possibly damaging 0.71
R0018:Reln UTSW 5 22,130,369 (GRCm39) missense probably benign 0.01
R0105:Reln UTSW 5 22,253,813 (GRCm39) missense probably damaging 0.99
R0105:Reln UTSW 5 22,253,813 (GRCm39) missense probably damaging 0.99
R0127:Reln UTSW 5 22,209,134 (GRCm39) missense probably damaging 1.00
R0135:Reln UTSW 5 22,333,647 (GRCm39) missense probably damaging 0.99
R0144:Reln UTSW 5 22,153,447 (GRCm39) missense probably damaging 0.97
R0240:Reln UTSW 5 22,311,043 (GRCm39) missense probably benign 0.36
R0240:Reln UTSW 5 22,311,043 (GRCm39) missense probably benign 0.36
R0242:Reln UTSW 5 22,147,595 (GRCm39) critical splice donor site probably null
R0242:Reln UTSW 5 22,147,595 (GRCm39) critical splice donor site probably null
R0266:Reln UTSW 5 22,193,774 (GRCm39) missense probably damaging 1.00
R0269:Reln UTSW 5 22,125,535 (GRCm39) missense probably damaging 1.00
R0280:Reln UTSW 5 22,432,511 (GRCm39) splice site probably benign
R0333:Reln UTSW 5 22,134,240 (GRCm39) missense probably damaging 0.97
R0357:Reln UTSW 5 22,155,820 (GRCm39) missense probably damaging 1.00
R0359:Reln UTSW 5 22,253,798 (GRCm39) missense probably damaging 0.98
R0506:Reln UTSW 5 22,125,494 (GRCm39) missense probably damaging 0.97
R0534:Reln UTSW 5 22,152,406 (GRCm39) missense probably damaging 0.99
R0535:Reln UTSW 5 22,256,274 (GRCm39) splice site probably benign
R0541:Reln UTSW 5 22,185,107 (GRCm39) missense possibly damaging 0.88
R0615:Reln UTSW 5 22,215,148 (GRCm39) missense probably benign 0.36
R0617:Reln UTSW 5 22,125,535 (GRCm39) missense probably damaging 1.00
R0634:Reln UTSW 5 22,223,867 (GRCm39) missense probably damaging 1.00
R0653:Reln UTSW 5 22,118,228 (GRCm39) missense probably benign 0.44
R0704:Reln UTSW 5 22,101,809 (GRCm39) missense probably damaging 0.99
R0706:Reln UTSW 5 22,101,809 (GRCm39) missense probably damaging 0.99
R0959:Reln UTSW 5 22,432,626 (GRCm39) missense probably damaging 0.96
R1066:Reln UTSW 5 22,239,662 (GRCm39) missense probably damaging 1.00
R1110:Reln UTSW 5 22,239,773 (GRCm39) missense probably benign
R1163:Reln UTSW 5 22,104,027 (GRCm39) missense probably benign 0.03
R1226:Reln UTSW 5 22,115,864 (GRCm39) missense probably damaging 1.00
R1440:Reln UTSW 5 22,333,600 (GRCm39) splice site probably benign
R1532:Reln UTSW 5 22,239,742 (GRCm39) missense probably damaging 0.99
R1552:Reln UTSW 5 22,165,376 (GRCm39) missense probably benign 0.01
R1565:Reln UTSW 5 22,130,211 (GRCm39) missense probably benign 0.05
R1618:Reln UTSW 5 22,265,366 (GRCm39) missense probably benign 0.01
R1636:Reln UTSW 5 22,203,681 (GRCm39) missense probably damaging 0.99
R1664:Reln UTSW 5 22,134,084 (GRCm39) missense probably damaging 1.00
R1716:Reln UTSW 5 22,160,093 (GRCm39) missense probably damaging 0.98
R1759:Reln UTSW 5 22,215,287 (GRCm39) missense probably damaging 0.99
R1835:Reln UTSW 5 22,184,000 (GRCm39) missense probably damaging 1.00
R1907:Reln UTSW 5 22,249,960 (GRCm39) critical splice donor site probably null
R1991:Reln UTSW 5 22,174,358 (GRCm39) missense possibly damaging 0.56
R2046:Reln UTSW 5 22,147,625 (GRCm39) missense probably benign 0.01
R2072:Reln UTSW 5 22,124,175 (GRCm39) missense probably damaging 1.00
R2103:Reln UTSW 5 22,174,358 (GRCm39) missense possibly damaging 0.56
R2119:Reln UTSW 5 22,223,998 (GRCm39) missense probably damaging 1.00
R2120:Reln UTSW 5 22,174,083 (GRCm39) missense probably damaging 1.00
R2216:Reln UTSW 5 22,253,003 (GRCm39) missense probably benign 0.30
R2219:Reln UTSW 5 22,177,045 (GRCm39) missense possibly damaging 0.88
R2228:Reln UTSW 5 22,192,076 (GRCm39) missense possibly damaging 0.69
R2306:Reln UTSW 5 22,101,784 (GRCm39) missense probably damaging 1.00
R2316:Reln UTSW 5 22,359,954 (GRCm39) missense probably benign 0.00
R2321:Reln UTSW 5 22,120,018 (GRCm39) missense probably damaging 0.99
R2512:Reln UTSW 5 22,184,688 (GRCm39) missense possibly damaging 0.89
R2519:Reln UTSW 5 22,549,367 (GRCm39) missense unknown
R2870:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2870:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2871:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2871:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2872:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2872:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R3195:Reln UTSW 5 22,245,418 (GRCm39) missense possibly damaging 0.72
R3545:Reln UTSW 5 22,432,598 (GRCm39) missense possibly damaging 0.64
R3546:Reln UTSW 5 22,432,598 (GRCm39) missense possibly damaging 0.64
R3547:Reln UTSW 5 22,432,598 (GRCm39) missense possibly damaging 0.64
R3706:Reln UTSW 5 22,200,587 (GRCm39) splice site probably benign
R3713:Reln UTSW 5 22,109,732 (GRCm39) missense probably damaging 0.99
R3770:Reln UTSW 5 22,153,564 (GRCm39) missense probably damaging 1.00
R3836:Reln UTSW 5 22,116,012 (GRCm39) missense probably damaging 1.00
R3887:Reln UTSW 5 22,115,847 (GRCm39) missense possibly damaging 0.92
R3972:Reln UTSW 5 22,183,999 (GRCm39) missense probably damaging 0.99
R3975:Reln UTSW 5 22,200,364 (GRCm39) missense possibly damaging 0.57
R4022:Reln UTSW 5 22,432,628 (GRCm39) missense probably benign 0.45
R4044:Reln UTSW 5 22,333,630 (GRCm39) missense possibly damaging 0.82
R4107:Reln UTSW 5 22,239,582 (GRCm39) missense probably damaging 1.00
R4297:Reln UTSW 5 22,125,485 (GRCm39) missense probably damaging 0.99
R4298:Reln UTSW 5 22,125,485 (GRCm39) missense probably damaging 0.99
R4299:Reln UTSW 5 22,125,485 (GRCm39) missense probably damaging 0.99
R4518:Reln UTSW 5 22,106,741 (GRCm39) missense probably benign 0.44
R4615:Reln UTSW 5 22,177,870 (GRCm39) missense possibly damaging 0.95
R4713:Reln UTSW 5 22,357,461 (GRCm39) missense probably benign 0.17
R4720:Reln UTSW 5 22,491,894 (GRCm39) missense possibly damaging 0.71
R4721:Reln UTSW 5 22,124,220 (GRCm39) missense probably damaging 0.99
R4771:Reln UTSW 5 22,254,698 (GRCm39) missense probably damaging 1.00
R4794:Reln UTSW 5 22,549,183 (GRCm39) missense probably damaging 0.98
R4840:Reln UTSW 5 22,223,844 (GRCm39) splice site probably null
R4860:Reln UTSW 5 22,106,749 (GRCm39) missense probably benign 0.06
R4860:Reln UTSW 5 22,106,749 (GRCm39) missense probably benign 0.06
R4896:Reln UTSW 5 22,160,236 (GRCm39) missense probably damaging 1.00
R4908:Reln UTSW 5 22,184,718 (GRCm39) missense probably benign 0.02
R4912:Reln UTSW 5 22,130,191 (GRCm39) missense probably benign 0.29
R4922:Reln UTSW 5 22,200,585 (GRCm39) critical splice acceptor site probably null
R4975:Reln UTSW 5 22,165,424 (GRCm39) missense probably damaging 1.00
R4976:Reln UTSW 5 22,176,868 (GRCm39) missense probably benign 0.05
R5020:Reln UTSW 5 22,239,636 (GRCm39) missense probably damaging 1.00
R5037:Reln UTSW 5 22,153,510 (GRCm39) missense probably damaging 1.00
R5082:Reln UTSW 5 22,101,075 (GRCm39) missense probably benign 0.00
R5119:Reln UTSW 5 22,176,868 (GRCm39) missense probably benign 0.05
R5125:Reln UTSW 5 22,118,239 (GRCm39) missense possibly damaging 0.78
R5137:Reln UTSW 5 22,160,179 (GRCm39) missense probably damaging 1.00
R5152:Reln UTSW 5 22,153,627 (GRCm39) missense probably damaging 1.00
R5154:Reln UTSW 5 22,193,763 (GRCm39) missense probably damaging 0.99
R5259:Reln UTSW 5 22,308,395 (GRCm39) missense possibly damaging 0.83
R5283:Reln UTSW 5 22,216,161 (GRCm39) missense probably damaging 1.00
R5386:Reln UTSW 5 22,244,527 (GRCm39) missense probably benign
R5400:Reln UTSW 5 22,184,712 (GRCm39) missense probably damaging 1.00
R5478:Reln UTSW 5 22,209,201 (GRCm39) missense probably benign 0.00
R5514:Reln UTSW 5 22,176,883 (GRCm39) missense possibly damaging 0.93
R5529:Reln UTSW 5 22,137,713 (GRCm39) missense possibly damaging 0.71
R5611:Reln UTSW 5 22,244,663 (GRCm39) nonsense probably null
R5648:Reln UTSW 5 22,203,570 (GRCm39) missense probably benign 0.04
R5649:Reln UTSW 5 22,106,623 (GRCm39) missense probably benign 0.33
R5744:Reln UTSW 5 22,311,081 (GRCm39) missense probably null 0.39
R5782:Reln UTSW 5 22,223,054 (GRCm39) missense probably benign 0.01
R5815:Reln UTSW 5 22,152,431 (GRCm39) missense probably damaging 0.99
R5838:Reln UTSW 5 22,104,111 (GRCm39) missense probably damaging 0.97
R6162:Reln UTSW 5 22,116,048 (GRCm39) missense probably damaging 1.00
R6219:Reln UTSW 5 22,153,594 (GRCm39) missense probably damaging 1.00
R6259:Reln UTSW 5 22,265,331 (GRCm39) missense probably damaging 0.99
R6279:Reln UTSW 5 22,101,839 (GRCm39) missense probably damaging 1.00
R6299:Reln UTSW 5 22,491,942 (GRCm39) missense possibly damaging 0.71
R6300:Reln UTSW 5 22,101,839 (GRCm39) missense probably damaging 1.00
R6314:Reln UTSW 5 22,357,482 (GRCm39) nonsense probably null
R6351:Reln UTSW 5 22,106,661 (GRCm39) nonsense probably null
R6369:Reln UTSW 5 22,256,359 (GRCm39) missense probably benign 0.03
R6371:Reln UTSW 5 22,200,511 (GRCm39) missense probably benign
R6374:Reln UTSW 5 22,285,712 (GRCm39) missense probably benign 0.06
R6425:Reln UTSW 5 22,116,018 (GRCm39) nonsense probably null
R6442:Reln UTSW 5 22,137,774 (GRCm39) missense probably benign
R6445:Reln UTSW 5 22,124,212 (GRCm39) missense probably benign 0.05
R6554:Reln UTSW 5 22,101,838 (GRCm39) missense probably damaging 1.00
R6641:Reln UTSW 5 22,134,132 (GRCm39) missense probably damaging 1.00
R6768:Reln UTSW 5 22,183,905 (GRCm39) missense probably damaging 0.99
R6859:Reln UTSW 5 22,239,568 (GRCm39) missense probably damaging 1.00
R6896:Reln UTSW 5 22,104,177 (GRCm39) missense probably benign 0.18
R6932:Reln UTSW 5 22,190,855 (GRCm39) missense probably benign 0.00
R6948:Reln UTSW 5 22,177,033 (GRCm39) missense probably damaging 1.00
R6959:Reln UTSW 5 22,181,562 (GRCm39) missense probably damaging 1.00
R7085:Reln UTSW 5 22,120,085 (GRCm39) nonsense probably null
R7091:Reln UTSW 5 22,104,027 (GRCm39) missense probably null 0.08
R7135:Reln UTSW 5 22,181,594 (GRCm39) missense possibly damaging 0.95
R7146:Reln UTSW 5 22,311,095 (GRCm39) missense probably damaging 0.97
R7167:Reln UTSW 5 22,147,618 (GRCm39) missense probably damaging 1.00
R7190:Reln UTSW 5 22,252,945 (GRCm39) missense probably damaging 1.00
R7256:Reln UTSW 5 22,183,921 (GRCm39) missense probably benign 0.03
R7393:Reln UTSW 5 22,181,349 (GRCm39) missense probably damaging 0.99
R7399:Reln UTSW 5 22,256,365 (GRCm39) missense probably damaging 0.99
R7400:Reln UTSW 5 22,176,932 (GRCm39) missense probably damaging 0.99
R7426:Reln UTSW 5 22,176,951 (GRCm39) missense probably damaging 1.00
R7463:Reln UTSW 5 22,308,433 (GRCm39) missense probably damaging 0.98
R7470:Reln UTSW 5 22,147,739 (GRCm39) missense probably damaging 0.99
R7473:Reln UTSW 5 22,134,125 (GRCm39) missense probably benign 0.25
R7501:Reln UTSW 5 22,432,636 (GRCm39) missense possibly damaging 0.91
R7542:Reln UTSW 5 22,160,179 (GRCm39) missense probably damaging 1.00
R7544:Reln UTSW 5 22,181,276 (GRCm39) nonsense probably null
R7588:Reln UTSW 5 22,090,566 (GRCm39) missense probably benign 0.03
R7631:Reln UTSW 5 22,176,933 (GRCm39) missense probably damaging 0.97
R7644:Reln UTSW 5 22,183,929 (GRCm39) missense probably benign 0.39
R7834:Reln UTSW 5 22,244,633 (GRCm39) missense possibly damaging 0.94
R7923:Reln UTSW 5 22,339,690 (GRCm39) missense probably benign 0.00
R7938:Reln UTSW 5 22,155,870 (GRCm39) missense probably damaging 0.97
R8006:Reln UTSW 5 22,104,082 (GRCm39) nonsense probably null
R8062:Reln UTSW 5 22,176,990 (GRCm39) missense probably benign 0.00
R8222:Reln UTSW 5 22,136,475 (GRCm39) nonsense probably null
R8266:Reln UTSW 5 22,223,085 (GRCm39) missense possibly damaging 0.62
R8267:Reln UTSW 5 22,209,110 (GRCm39) missense probably damaging 1.00
R8487:Reln UTSW 5 22,104,027 (GRCm39) missense probably benign 0.03
R8523:Reln UTSW 5 22,209,229 (GRCm39) missense probably damaging 1.00
R8751:Reln UTSW 5 22,147,672 (GRCm39) missense probably benign 0.37
R8801:Reln UTSW 5 22,155,854 (GRCm39) missense possibly damaging 0.94
R8802:Reln UTSW 5 22,130,257 (GRCm39) missense probably damaging 0.98
R8978:Reln UTSW 5 22,090,512 (GRCm39) missense possibly damaging 0.85
R8988:Reln UTSW 5 22,104,155 (GRCm39) missense probably damaging 0.97
R8995:Reln UTSW 5 22,184,577 (GRCm39) missense probably benign 0.00
R9022:Reln UTSW 5 22,181,613 (GRCm39) missense possibly damaging 0.66
R9042:Reln UTSW 5 22,253,036 (GRCm39) missense probably damaging 1.00
R9069:Reln UTSW 5 22,216,059 (GRCm39) missense probably damaging 1.00
R9089:Reln UTSW 5 22,130,198 (GRCm39) missense probably benign 0.01
R9126:Reln UTSW 5 22,160,194 (GRCm39) missense probably damaging 1.00
R9172:Reln UTSW 5 22,155,815 (GRCm39) critical splice donor site probably null
R9182:Reln UTSW 5 22,106,617 (GRCm39) missense probably benign 0.44
R9196:Reln UTSW 5 22,357,471 (GRCm39) missense probably damaging 1.00
R9211:Reln UTSW 5 22,549,200 (GRCm39) nonsense probably null
R9241:Reln UTSW 5 22,174,067 (GRCm39) missense probably damaging 0.99
R9244:Reln UTSW 5 22,120,151 (GRCm39) missense probably damaging 0.99
R9281:Reln UTSW 5 22,153,545 (GRCm39) missense probably damaging 1.00
R9295:Reln UTSW 5 22,209,209 (GRCm39) missense possibly damaging 0.95
R9303:Reln UTSW 5 22,193,705 (GRCm39) missense possibly damaging 0.95
R9303:Reln UTSW 5 22,285,689 (GRCm39) missense probably benign 0.01
R9309:Reln UTSW 5 22,176,866 (GRCm39) missense probably benign 0.37
R9338:Reln UTSW 5 22,202,937 (GRCm39) missense probably damaging 0.98
R9381:Reln UTSW 5 22,549,202 (GRCm39) missense possibly damaging 0.93
R9430:Reln UTSW 5 22,120,105 (GRCm39) missense probably damaging 1.00
R9509:Reln UTSW 5 22,549,198 (GRCm39) missense possibly damaging 0.93
R9515:Reln UTSW 5 22,125,508 (GRCm39) missense possibly damaging 0.46
R9717:Reln UTSW 5 22,136,427 (GRCm39) missense probably benign 0.26
R9745:Reln UTSW 5 22,152,525 (GRCm39) missense probably damaging 1.00
R9778:Reln UTSW 5 22,155,943 (GRCm39) missense probably damaging 1.00
Z1176:Reln UTSW 5 22,184,022 (GRCm39) missense probably damaging 1.00
Z1177:Reln UTSW 5 22,209,080 (GRCm39) missense probably damaging 0.96
Z1177:Reln UTSW 5 22,174,239 (GRCm39) missense probably damaging 0.96
Z1177:Reln UTSW 5 22,432,634 (GRCm39) missense probably damaging 1.00
Z1177:Reln UTSW 5 22,359,957 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCACAAATGGCTTGCCCAAGTTC -3'
(R):5'- CACCCCTAACCACAGTGAGATGTTC -3'

Sequencing Primer
(F):5'- CATGGAGGAATCGTTTCAGACATC -3'
(R):5'- CCACAGTGAGATGTTCGACAG -3'
Posted On 2014-01-29