Incidental Mutation 'R1222:Ankrd13a'
ID152753
Institutional Source Beutler Lab
Gene Symbol Ankrd13a
Ensembl Gene ENSMUSG00000041870
Gene Nameankyrin repeat domain 13a
Synonyms
MMRRC Submission 039291-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R1222 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location114774677-114806200 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 114800763 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 365 (C365*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102578]
Predicted Effect probably null
Transcript: ENSMUST00000102578
AA Change: C431*
SMART Domains Protein: ENSMUSP00000099638
Gene: ENSMUSG00000041870
AA Change: C431*

DomainStartEndE-ValueType
ANK 40 69 1.51e-4 SMART
ANK 73 104 2.03e-1 SMART
Pfam:GPCR_chapero_1 156 468 5.5e-107 PFAM
UIM 480 500 2.98e2 SMART
UIM 517 536 2.01e1 SMART
UIM 547 566 5.33e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131803
Predicted Effect probably null
Transcript: ENSMUST00000137519
AA Change: C365*
SMART Domains Protein: ENSMUSP00000116994
Gene: ENSMUSG00000041870
AA Change: C365*

DomainStartEndE-ValueType
ANK 7 38 2.03e-1 SMART
Pfam:GPCR_chapero_1 90 403 8.2e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200704
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,145,064 probably benign Het
Abl1 T C 2: 31,800,994 S842P probably benign Het
Agrn C A 4: 156,177,385 V483L probably damaging Het
Ap2b1 T C 11: 83,346,738 S543P probably benign Het
Atic C T 1: 71,559,279 T67I probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cux1 C T 5: 136,275,149 R1391Q probably benign Het
Cyp2a4 T C 7: 26,308,588 V140A possibly damaging Het
Dlgap3 A T 4: 127,194,613 M1L probably null Het
Dnah3 T C 7: 120,090,676 D2G probably benign Het
Erbb3 A C 10: 128,571,665 V938G probably damaging Het
Fam13a C T 6: 58,935,722 probably benign Het
Gata2 G A 6: 88,200,341 V118I probably benign Het
Gm2663 T C 6: 40,996,041 I211V probably benign Het
Gm5096 A G 18: 87,757,334 K327R probably damaging Het
Gm8298 T A 3: 59,877,261 L385* probably null Het
Izumo3 T A 4: 92,145,047 N104I probably damaging Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Mctp2 T A 7: 72,259,139 H142L probably benign Het
Mmp10 T C 9: 7,505,681 probably benign Het
Mroh8 G A 2: 157,241,854 probably benign Het
Mylk T C 16: 34,860,652 V94A probably benign Het
Nol6 A T 4: 41,120,760 N396K probably benign Het
Nr4a2 A T 2: 57,108,324 N543K probably damaging Het
Nynrin T C 14: 55,863,541 S263P probably benign Het
Olfr1115 G T 2: 87,252,422 G162C probably benign Het
Olfr395 A T 11: 73,907,414 L26H probably damaging Het
Olfr493 T A 7: 108,346,106 I292F probably damaging Het
Olfr77 G A 9: 19,921,048 V280I possibly damaging Het
Pkhd1 T A 1: 20,567,456 R368S probably benign Het
Plekhg4 G A 8: 105,379,110 A736T probably benign Het
Plxna2 A G 1: 194,800,649 D1550G probably damaging Het
Qrfpr C A 3: 36,180,095 G366W probably damaging Het
Qser1 C A 2: 104,777,431 A1471S probably damaging Het
Rars A T 11: 35,809,740 Y505N probably damaging Het
Reln T A 5: 21,986,955 T1496S probably null Het
Rrs1 T C 1: 9,545,855 L111P probably benign Het
Selplg C T 5: 113,819,373 V291M possibly damaging Het
Serpinb1c T A 13: 32,896,951 T50S possibly damaging Het
Slc4a5 A G 6: 83,280,132 K640E probably damaging Het
Szt2 A T 4: 118,405,459 H40Q possibly damaging Het
Taar4 C T 10: 23,961,332 T280I probably benign Het
Tdo2 A G 3: 81,961,468 probably null Het
Tpp1 T C 7: 105,746,741 N527S probably benign Het
Trim43c A T 9: 88,843,078 T218S possibly damaging Het
Trim45 G T 3: 100,927,298 M432I probably benign Het
Ubr4 T C 4: 139,388,471 probably null Het
Vat1l T C 8: 114,282,361 probably benign Het
Xpo7 A T 14: 70,667,084 H1037Q possibly damaging Het
Zmiz1 T C 14: 25,658,096 probably benign Het
Other mutations in Ankrd13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Ankrd13a APN 5 114801802 missense probably damaging 0.99
IGL01303:Ankrd13a APN 5 114786002 missense possibly damaging 0.94
IGL01392:Ankrd13a APN 5 114797853 missense probably benign
IGL01480:Ankrd13a APN 5 114800818 splice site probably benign
IGL01652:Ankrd13a APN 5 114791336 missense probably damaging 1.00
IGL02213:Ankrd13a APN 5 114785968 missense probably damaging 1.00
IGL02512:Ankrd13a APN 5 114786766 missense probably benign 0.16
IGL03268:Ankrd13a APN 5 114792235 missense probably damaging 1.00
R0019:Ankrd13a UTSW 5 114786081 splice site probably benign
R0019:Ankrd13a UTSW 5 114786081 splice site probably benign
R0465:Ankrd13a UTSW 5 114804234 missense probably damaging 0.98
R0960:Ankrd13a UTSW 5 114786807 missense probably benign 0.03
R1538:Ankrd13a UTSW 5 114804234 missense possibly damaging 0.87
R1667:Ankrd13a UTSW 5 114786733 missense possibly damaging 0.89
R1771:Ankrd13a UTSW 5 114803588 missense probably benign 0.08
R2015:Ankrd13a UTSW 5 114792109 missense probably damaging 1.00
R4547:Ankrd13a UTSW 5 114775296 missense probably benign 0.01
R4569:Ankrd13a UTSW 5 114789312 missense probably damaging 1.00
R5401:Ankrd13a UTSW 5 114792173 missense probably damaging 1.00
R5635:Ankrd13a UTSW 5 114801717 missense possibly damaging 0.95
R6238:Ankrd13a UTSW 5 114786726 missense probably benign 0.00
R6562:Ankrd13a UTSW 5 114804392 unclassified probably benign
R6623:Ankrd13a UTSW 5 114786757 missense probably benign 0.28
R6772:Ankrd13a UTSW 5 114801743 missense probably benign 0.00
R7146:Ankrd13a UTSW 5 114775232 missense probably damaging 1.00
R7440:Ankrd13a UTSW 5 114803575 missense possibly damaging 0.65
R7567:Ankrd13a UTSW 5 114789484 intron probably null
R7849:Ankrd13a UTSW 5 114791282 missense possibly damaging 0.89
R7932:Ankrd13a UTSW 5 114791282 missense possibly damaging 0.89
R8006:Ankrd13a UTSW 5 114804423 makesense probably null
Predicted Primers PCR Primer
(F):5'- TGCTCTCCACCACTCCTAGATAACG -3'
(R):5'- AGACCACGGCTGAAGCATATCCTC -3'

Sequencing Primer
(F):5'- CCACTCCTAGATAACGGTTGAATG -3'
(R):5'- AGTTGTTTCCCACTTAATCCAAACTC -3'
Posted On2014-01-29