Mutagenetix > Incidental Mutation

Incidental Mutation 'R1222:Ap2b1'

152775

Institutional Source

Beutler Lab

Gene Symbol

Ap2b1

Ensembl Gene

ENSMUSG00000035152

Gene Name

adaptor-related protein complex 2, beta 1 subunit

Synonyms

1300012O03Rik

MMRRC Submission

039291-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1222 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83299024-83405035 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 83346738 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 543 (S543P)

Ref Sequence

ENSEMBL: ENSMUSP00000134779 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523]

AlphaFold

Q9DBG3

Predicted Effect

probably benign
Transcript: ENSMUST00000018875
AA Change: S543P

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: S543P

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	2.6e-173	PFAM
Pfam:HEAT_2	88	157	3.7e-8	PFAM
Pfam:Cnd1	99	268	2.1e-40	PFAM
Pfam:HEAT_2	124	219	1.4e-9	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	950	9.93e-56	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000065692
AA Change: S543P

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: S543P

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4.2e-173	PFAM
Pfam:HEAT_2	88	157	2.7e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
Alpha_adaptinC2	707	817	2.94e-18	SMART
B2-adapt-app_C	826	936	9.93e-56	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132178

Predicted Effect

probably benign
Transcript: ENSMUST00000176430
AA Change: S543P

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: S543P

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4e-173	PFAM
Pfam:HEAT_2	88	157	2.8e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	936	7.22e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176523
AA Change: S505P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: S505P

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	95	1.1e-26	PFAM
Pfam:Cnd1	69	230	1.5e-26	PFAM
Pfam:HEAT_2	85	182	5.1e-9	PFAM
Pfam:Adaptin_N	90	496	4e-125	PFAM
low complexity region	587	605	N/A	INTRINSIC
low complexity region	616	637	N/A	INTRINSIC
Alpha_adaptinC2	683	793	2.94e-18	SMART
B2-adapt-app_C	802	912	9.93e-56	SMART

Meta Mutation Damage Score

0.0783

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

96% (54/56)

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	T	C	11: 110,145,064		probably benign	Het
Abl1	T	C	2: 31,800,994	S842P	probably benign	Het
Agrn	C	A	4: 156,177,385	V483L	probably damaging	Het
Ankrd13a	T	A	5: 114,800,763	C365*	probably null	Het
Atic	C	T	1: 71,559,279	T67I	probably damaging	Het
Car9	G	T	4: 43,512,439		probably null	Het
Cux1	C	T	5: 136,275,149	R1391Q	probably benign	Het
Cyp2a4	T	C	7: 26,308,588	V140A	possibly damaging	Het
Dlgap3	A	T	4: 127,194,613	M1L	probably null	Het
Dnah3	T	C	7: 120,090,676	D2G	probably benign	Het
Erbb3	A	C	10: 128,571,665	V938G	probably damaging	Het
Fam13a	C	T	6: 58,935,722		probably benign	Het
Gata2	G	A	6: 88,200,341	V118I	probably benign	Het
Gm2663	T	C	6: 40,996,041	I211V	probably benign	Het
Gm5096	A	G	18: 87,757,334	K327R	probably damaging	Het
Gm8298	T	A	3: 59,877,261	L385*	probably null	Het
Izumo3	T	A	4: 92,145,047	N104I	probably damaging	Het
Kifc1	G	A	17: 33,884,711	R195C	probably benign	Het
Mctp2	T	A	7: 72,259,139	H142L	probably benign	Het
Mmp10	T	C	9: 7,505,681		probably benign	Het
Mroh8	G	A	2: 157,241,854		probably benign	Het
Mylk	T	C	16: 34,860,652	V94A	probably benign	Het
Nol6	A	T	4: 41,120,760	N396K	probably benign	Het
Nr4a2	A	T	2: 57,108,324	N543K	probably damaging	Het
Nynrin	T	C	14: 55,863,541	S263P	probably benign	Het
Olfr1115	G	T	2: 87,252,422	G162C	probably benign	Het
Olfr395	A	T	11: 73,907,414	L26H	probably damaging	Het
Olfr493	T	A	7: 108,346,106	I292F	probably damaging	Het
Olfr77	G	A	9: 19,921,048	V280I	possibly damaging	Het
Pkhd1	T	A	1: 20,567,456	R368S	probably benign	Het
Plekhg4	G	A	8: 105,379,110	A736T	probably benign	Het
Plxna2	A	G	1: 194,800,649	D1550G	probably damaging	Het
Qrfpr	C	A	3: 36,180,095	G366W	probably damaging	Het
Qser1	C	A	2: 104,777,431	A1471S	probably damaging	Het
Rars	A	T	11: 35,809,740	Y505N	probably damaging	Het
Reln	T	A	5: 21,986,955	T1496S	probably null	Het
Rrs1	T	C	1: 9,545,855	L111P	probably benign	Het
Selplg	C	T	5: 113,819,373	V291M	possibly damaging	Het
Serpinb1c	T	A	13: 32,896,951	T50S	possibly damaging	Het
Slc4a5	A	G	6: 83,280,132	K640E	probably damaging	Het
Szt2	A	T	4: 118,405,459	H40Q	possibly damaging	Het
Taar4	C	T	10: 23,961,332	T280I	probably benign	Het
Tdo2	A	G	3: 81,961,468		probably null	Het
Tpp1	T	C	7: 105,746,741	N527S	probably benign	Het
Trim43c	A	T	9: 88,843,078	T218S	possibly damaging	Het
Trim45	G	T	3: 100,927,298	M432I	probably benign	Het
Ubr4	T	C	4: 139,388,471		probably null	Het
Vat1l	T	C	8: 114,282,361		probably benign	Het
Xpo7	A	T	14: 70,667,084	H1037Q	possibly damaging	Het
Zmiz1	T	C	14: 25,658,096		probably benign	Het

Other mutations in Ap2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Ap2b1	APN	11	83333158	missense	probably damaging	0.99
IGL01583:Ap2b1	APN	11	83324611	missense	possibly damaging	0.61
IGL01753:Ap2b1	APN	11	83321973	missense	probably damaging	1.00
IGL01992:Ap2b1	APN	11	83335530	missense	probably damaging	1.00
IGL02192:Ap2b1	APN	11	83346766	missense	possibly damaging	0.48
IGL02315:Ap2b1	APN	11	83336799	missense	probably damaging	0.96
IGL03235:Ap2b1	APN	11	83341384	missense	probably benign	0.41
P0045:Ap2b1	UTSW	11	83368026	missense	probably damaging	1.00
R0121:Ap2b1	UTSW	11	83321967	missense	possibly damaging	0.66
R0334:Ap2b1	UTSW	11	83367874	splice site	probably benign
R1297:Ap2b1	UTSW	11	83333109	missense	probably damaging	1.00
R1653:Ap2b1	UTSW	11	83346831	missense	probably damaging	1.00
R1719:Ap2b1	UTSW	11	83324604	missense	probably damaging	1.00
R1885:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1886:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1965:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R1966:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R2046:Ap2b1	UTSW	11	83336386	missense	probably benign	0.14
R2086:Ap2b1	UTSW	11	83351118	missense	possibly damaging	0.88
R2132:Ap2b1	UTSW	11	83324761	splice site	probably benign
R3615:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3616:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3983:Ap2b1	UTSW	11	83390716	missense	probably damaging	1.00
R4124:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4125:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4198:Ap2b1	UTSW	11	83342603	missense	probably damaging	1.00
R4202:Ap2b1	UTSW	11	83335604	critical splice donor site	probably null
R4543:Ap2b1	UTSW	11	83324650	missense	probably damaging	1.00
R4583:Ap2b1	UTSW	11	83397779	missense	probably benign	0.00
R4589:Ap2b1	UTSW	11	83333011	nonsense	probably null
R4916:Ap2b1	UTSW	11	83390706	missense	probably damaging	1.00
R5005:Ap2b1	UTSW	11	83339392	missense	probably damaging	1.00
R5385:Ap2b1	UTSW	11	83342601	missense	probably damaging	1.00
R5510:Ap2b1	UTSW	11	83336737	splice site	probably null
R5738:Ap2b1	UTSW	11	83336430	splice site	probably null
R6023:Ap2b1	UTSW	11	83335398	missense	probably damaging	0.99
R6269:Ap2b1	UTSW	11	83346673	missense	probably damaging	1.00
R6383:Ap2b1	UTSW	11	83346825	missense	probably damaging	1.00
R6416:Ap2b1	UTSW	11	83308239	start codon destroyed	probably null	1.00
R6502:Ap2b1	UTSW	11	83342679	missense	probably damaging	0.97
R6810:Ap2b1	UTSW	11	83335491	missense	possibly damaging	0.89
R6969:Ap2b1	UTSW	11	83389726	missense	probably damaging	0.99
R7238:Ap2b1	UTSW	11	83333122	missense	possibly damaging	0.91
R7241:Ap2b1	UTSW	11	83351105	missense	probably benign	0.16
R7429:Ap2b1	UTSW	11	83367998	missense	probably benign	0.00
R7588:Ap2b1	UTSW	11	83324522	missense	probably benign	0.00
R7635:Ap2b1	UTSW	11	83389728	missense	probably benign	0.09
R7651:Ap2b1	UTSW	11	83339430	critical splice donor site	probably null
R7753:Ap2b1	UTSW	11	83367907	nonsense	probably null
R8468:Ap2b1	UTSW	11	83351065	missense	probably damaging	1.00
R8943:Ap2b1	UTSW	11	83346753	missense	probably damaging	1.00
R9093:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
R9621:Ap2b1	UTSW	11	83402598	missense	probably damaging	1.00
X0064:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
Z1177:Ap2b1	UTSW	11	83365753	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCTAATCTGCATAAGTCGCTACCACAG -3'
(R):5'- CACTTCTTGCTGAAGAGACCTCCAC -3'

Sequencing Primer
(F):5'- CAGTGCCATGACAGTAAGTCTG -3'
(R):5'- GAAGAGACCTCCACCTGCTC -3'

Posted On

2014-01-29