Incidental Mutation 'R1223:Sptbn5'
ID 152789
Institutional Source Beutler Lab
Gene Symbol Sptbn5
Ensembl Gene ENSMUSG00000074899
Gene Name spectrin beta, non-erythrocytic 5
Synonyms Spnb5, EG640524
MMRRC Submission 039292-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.181) question?
Stock # R1223 (G1)
Quality Score 214
Status Not validated
Chromosome 2
Chromosomal Location 119871974-119916159 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119902525 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 68 (I68F)
Ref Sequence ENSEMBL: ENSMUSP00000106384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110756]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000110756
AA Change: I68F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106384
Gene: ENSMUSG00000074899
AA Change: I68F

DomainStartEndE-ValueType
SPEC 13 111 6.45e-8 SMART
Blast:SPEC 117 206 9e-12 BLAST
SPEC 219 323 3.76e-1 SMART
SPEC 325 425 3.48e-13 SMART
SPEC 431 530 1.09e-5 SMART
SPEC 536 631 1.22e-1 SMART
SPEC 637 737 1.78e-10 SMART
SPEC 743 837 4.73e-15 SMART
SPEC 843 944 4.24e-17 SMART
SPEC 950 1051 1.36e-15 SMART
Blast:SPEC 1057 1130 2e-40 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134935
SMART Domains Protein: ENSMUSP00000116766
Gene: ENSMUSG00000074899

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
CH 53 154 1.9e-16 SMART
CH 176 274 3.02e-19 SMART
SPEC 306 412 8.64e-1 SMART
SPEC 426 527 3.85e-6 SMART
SPEC 533 632 1.38e-7 SMART
SPEC 638 738 9.46e-15 SMART
coiled coil region 780 809 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156159
SMART Domains Protein: ENSMUSP00000115974
Gene: ENSMUSG00000074899

DomainStartEndE-ValueType
SPEC 60 160 2.54e-6 SMART
SPEC 166 266 1.32e-13 SMART
SPEC 272 372 4.41e-15 SMART
SPEC 378 477 1.56e-15 SMART
SPEC 483 583 1.11e-11 SMART
SPEC 589 689 8.47e-26 SMART
SPEC 695 795 5.56e-12 SMART
SPEC 801 902 7.01e-9 SMART
SPEC 908 1032 4.44e-1 SMART
SPEC 1038 1138 3.73e-13 SMART
Pfam:Spectrin 1141 1206 2.2e-6 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A T 16: 4,116,612 (GRCm39) V873E probably damaging Het
Arl10 A G 13: 54,726,744 (GRCm39) D174G probably damaging Het
Cd180 A T 13: 102,842,730 (GRCm39) Y592F possibly damaging Het
Ces3a A T 8: 105,784,661 (GRCm39) T548S probably benign Het
Chd2 T C 7: 73,134,265 (GRCm39) E694G probably damaging Het
Commd3 T C 2: 18,679,779 (GRCm39) Y163H probably benign Het
Cyp8b1 A G 9: 121,744,070 (GRCm39) S421P possibly damaging Het
Cysltr2 A T 14: 73,267,539 (GRCm39) V57E probably damaging Het
Ddx47 G A 6: 134,989,277 (GRCm39) V34I possibly damaging Het
Dgkz T C 2: 91,769,660 (GRCm39) probably benign Het
Dsg2 G T 18: 20,706,550 (GRCm39) C22F probably benign Het
Gbp10 A C 5: 105,366,867 (GRCm39) V455G probably damaging Het
Gm12185 T A 11: 48,798,103 (GRCm39) I797F probably damaging Het
Katnip T A 7: 125,359,595 (GRCm39) V62E possibly damaging Het
Lrrk2 A G 15: 91,557,838 (GRCm39) E58G probably benign Het
Mrgprb1 A G 7: 48,097,435 (GRCm39) V159A possibly damaging Het
Mybphl A G 3: 108,282,512 (GRCm39) T182A possibly damaging Het
Or52e7 A T 7: 104,684,773 (GRCm39) I123F probably benign Het
Or9m1 G A 2: 87,733,163 (GRCm39) P286S probably damaging Het
Osr1 C T 12: 9,629,699 (GRCm39) L191F probably damaging Het
Pip4k2b G A 11: 97,609,720 (GRCm39) R406C probably damaging Het
Plce1 C T 19: 38,690,457 (GRCm39) L714F probably damaging Het
Plce1 T C 19: 38,755,670 (GRCm39) F1886S probably damaging Het
Ppp1cc A G 5: 122,306,277 (GRCm39) E32G probably damaging Het
Rnh1 A G 7: 140,743,120 (GRCm39) L260P probably damaging Het
Serpinb3a T A 1: 106,975,282 (GRCm39) N175I probably damaging Het
Tas1r2 A T 4: 139,387,515 (GRCm39) T325S probably damaging Het
Tcirg1 T C 19: 3,948,733 (GRCm39) N484S probably benign Het
Tenm3 A T 8: 48,693,431 (GRCm39) M1833K possibly damaging Het
Thoc5 A G 11: 4,871,922 (GRCm39) E449G probably benign Het
Usp34 A G 11: 23,396,464 (GRCm39) probably null Het
Other mutations in Sptbn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Sptbn5 APN 2 119,884,948 (GRCm39) unclassified probably benign
IGL01552:Sptbn5 APN 2 119,884,903 (GRCm39) unclassified probably benign
IGL01800:Sptbn5 APN 2 119,886,908 (GRCm39) unclassified probably benign
IGL02156:Sptbn5 APN 2 119,878,098 (GRCm39) unclassified probably benign
R0020:Sptbn5 UTSW 2 119,896,112 (GRCm39) missense probably damaging 0.96
R0690:Sptbn5 UTSW 2 119,893,156 (GRCm39) splice site probably null
R1121:Sptbn5 UTSW 2 119,899,871 (GRCm39) splice site probably null
R1405:Sptbn5 UTSW 2 119,881,097 (GRCm39) splice site noncoding transcript
R1852:Sptbn5 UTSW 2 119,902,125 (GRCm39) missense possibly damaging 0.52
R1927:Sptbn5 UTSW 2 119,900,943 (GRCm39) missense probably benign 0.00
R2570:Sptbn5 UTSW 2 119,879,121 (GRCm39) exon noncoding transcript
R3898:Sptbn5 UTSW 2 119,887,691 (GRCm39) exon noncoding transcript
R3976:Sptbn5 UTSW 2 119,878,742 (GRCm39) splice site noncoding transcript
R4092:Sptbn5 UTSW 2 119,897,532 (GRCm39) missense probably damaging 0.99
R4119:Sptbn5 UTSW 2 119,895,010 (GRCm39) missense possibly damaging 0.91
R4120:Sptbn5 UTSW 2 119,895,010 (GRCm39) missense possibly damaging 0.91
R4351:Sptbn5 UTSW 2 119,913,680 (GRCm39) exon noncoding transcript
R4352:Sptbn5 UTSW 2 119,913,680 (GRCm39) exon noncoding transcript
R4364:Sptbn5 UTSW 2 119,899,136 (GRCm39) missense probably damaging 1.00
R4371:Sptbn5 UTSW 2 119,896,475 (GRCm39) missense probably damaging 1.00
R4606:Sptbn5 UTSW 2 119,897,927 (GRCm39) splice site probably null
R4616:Sptbn5 UTSW 2 119,879,238 (GRCm39) exon noncoding transcript
R4687:Sptbn5 UTSW 2 119,907,689 (GRCm39) unclassified probably benign
R4693:Sptbn5 UTSW 2 119,889,897 (GRCm39) unclassified probably benign
R4762:Sptbn5 UTSW 2 119,907,703 (GRCm39) unclassified noncoding transcript
R4798:Sptbn5 UTSW 2 119,889,622 (GRCm39) unclassified probably benign
R4818:Sptbn5 UTSW 2 119,898,449 (GRCm39) missense probably benign 0.05
R4822:Sptbn5 UTSW 2 119,898,449 (GRCm39) missense probably benign 0.05
R4825:Sptbn5 UTSW 2 119,886,374 (GRCm39) unclassified probably benign
R4933:Sptbn5 UTSW 2 119,880,601 (GRCm39) exon noncoding transcript
R4970:Sptbn5 UTSW 2 119,882,258 (GRCm39) exon noncoding transcript
R5141:Sptbn5 UTSW 2 119,892,212 (GRCm39) missense probably benign 0.03
R5209:Sptbn5 UTSW 2 119,902,483 (GRCm39) missense probably benign 0.09
R5225:Sptbn5 UTSW 2 119,915,812 (GRCm39) unclassified probably benign
R5227:Sptbn5 UTSW 2 119,915,812 (GRCm39) unclassified probably benign
R5421:Sptbn5 UTSW 2 119,911,261 (GRCm39) critical splice donor site noncoding transcript
R5495:Sptbn5 UTSW 2 119,876,965 (GRCm39) unclassified probably benign
R5498:Sptbn5 UTSW 2 119,907,119 (GRCm39) unclassified probably benign
R5511:Sptbn5 UTSW 2 119,890,202 (GRCm39) unclassified probably benign
R5596:Sptbn5 UTSW 2 119,876,965 (GRCm39) unclassified probably benign
R5616:Sptbn5 UTSW 2 119,876,965 (GRCm39) unclassified probably benign
R5617:Sptbn5 UTSW 2 119,876,965 (GRCm39) unclassified probably benign
R5619:Sptbn5 UTSW 2 119,880,613 (GRCm39) exon noncoding transcript
R5625:Sptbn5 UTSW 2 119,910,273 (GRCm39) exon noncoding transcript
R5636:Sptbn5 UTSW 2 119,887,885 (GRCm39) unclassified probably benign
R5646:Sptbn5 UTSW 2 119,879,292 (GRCm39) splice site noncoding transcript
R5666:Sptbn5 UTSW 2 119,916,048 (GRCm39) unclassified probably benign
R5670:Sptbn5 UTSW 2 119,916,048 (GRCm39) unclassified probably benign
R5715:Sptbn5 UTSW 2 119,902,985 (GRCm39) missense probably damaging 1.00
R5774:Sptbn5 UTSW 2 119,880,939 (GRCm39) exon noncoding transcript
R5885:Sptbn5 UTSW 2 119,907,144 (GRCm39) unclassified probably benign
R6016:Sptbn5 UTSW 2 119,880,573 (GRCm39) exon noncoding transcript
R6183:Sptbn5 UTSW 2 119,889,898 (GRCm39) unclassified probably benign
R6184:Sptbn5 UTSW 2 119,889,898 (GRCm39) unclassified probably benign
R6219:Sptbn5 UTSW 2 119,907,803 (GRCm39) unclassified probably benign
R6335:Sptbn5 UTSW 2 119,884,900 (GRCm39) unclassified probably benign
R6383:Sptbn5 UTSW 2 119,876,750 (GRCm39) unclassified probably benign
R6450:Sptbn5 UTSW 2 119,877,616 (GRCm39) unclassified probably benign
R6516:Sptbn5 UTSW 2 119,878,431 (GRCm39) unclassified probably benign
R6523:Sptbn5 UTSW 2 119,896,095 (GRCm39) splice site probably null
R6657:Sptbn5 UTSW 2 119,906,881 (GRCm39) unclassified probably benign
R6661:Sptbn5 UTSW 2 119,902,856 (GRCm39) missense possibly damaging 0.62
R8208:Sptbn5 UTSW 2 119,878,326 (GRCm39) nonsense noncoding transcript
R8261:Sptbn5 UTSW 2 119,877,616 (GRCm39) missense noncoding transcript
R8300:Sptbn5 UTSW 2 119,878,058 (GRCm39) missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- AGCTTCTTGTTCCCAGAGTCTCCAG -3'
(R):5'- TTAGAGCCAAGCATCCCAAGGTCC -3'

Sequencing Primer
(F):5'- GTTCAGACTCCTGTAAAAGACTGC -3'
(R):5'- AAGCATCCCAAGGTCCTTTGTC -3'
Posted On 2014-01-29