Incidental Mutation 'R1223:Mybphl'
ID 152790
Institutional Source Beutler Lab
Gene Symbol Mybphl
Ensembl Gene ENSMUSG00000068745
Gene Name myosin binding protein H-like
Synonyms 1110037P11Rik
MMRRC Submission 039292-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R1223 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 108272227-108287373 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108282512 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 182 (T182A)
Ref Sequence ENSEMBL: ENSMUSP00000088051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090563]
AlphaFold Q5FW53
Predicted Effect possibly damaging
Transcript: ENSMUST00000090563
AA Change: T182A

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088051
Gene: ENSMUSG00000068745
AA Change: T182A

DomainStartEndE-ValueType
IG 61 144 4.67e-4 SMART
FN3 147 229 1.62e-10 SMART
IG 268 352 3.68e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142833
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two immunoglobulin superfamily domains and a fibronectin 3 domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A T 16: 4,116,612 (GRCm39) V873E probably damaging Het
Arl10 A G 13: 54,726,744 (GRCm39) D174G probably damaging Het
Cd180 A T 13: 102,842,730 (GRCm39) Y592F possibly damaging Het
Ces3a A T 8: 105,784,661 (GRCm39) T548S probably benign Het
Chd2 T C 7: 73,134,265 (GRCm39) E694G probably damaging Het
Commd3 T C 2: 18,679,779 (GRCm39) Y163H probably benign Het
Cyp8b1 A G 9: 121,744,070 (GRCm39) S421P possibly damaging Het
Cysltr2 A T 14: 73,267,539 (GRCm39) V57E probably damaging Het
Ddx47 G A 6: 134,989,277 (GRCm39) V34I possibly damaging Het
Dgkz T C 2: 91,769,660 (GRCm39) probably benign Het
Dsg2 G T 18: 20,706,550 (GRCm39) C22F probably benign Het
Gbp10 A C 5: 105,366,867 (GRCm39) V455G probably damaging Het
Gm12185 T A 11: 48,798,103 (GRCm39) I797F probably damaging Het
Katnip T A 7: 125,359,595 (GRCm39) V62E possibly damaging Het
Lrrk2 A G 15: 91,557,838 (GRCm39) E58G probably benign Het
Mrgprb1 A G 7: 48,097,435 (GRCm39) V159A possibly damaging Het
Or52e7 A T 7: 104,684,773 (GRCm39) I123F probably benign Het
Or9m1 G A 2: 87,733,163 (GRCm39) P286S probably damaging Het
Osr1 C T 12: 9,629,699 (GRCm39) L191F probably damaging Het
Pip4k2b G A 11: 97,609,720 (GRCm39) R406C probably damaging Het
Plce1 C T 19: 38,690,457 (GRCm39) L714F probably damaging Het
Plce1 T C 19: 38,755,670 (GRCm39) F1886S probably damaging Het
Ppp1cc A G 5: 122,306,277 (GRCm39) E32G probably damaging Het
Rnh1 A G 7: 140,743,120 (GRCm39) L260P probably damaging Het
Serpinb3a T A 1: 106,975,282 (GRCm39) N175I probably damaging Het
Sptbn5 T A 2: 119,902,525 (GRCm39) I68F probably damaging Het
Tas1r2 A T 4: 139,387,515 (GRCm39) T325S probably damaging Het
Tcirg1 T C 19: 3,948,733 (GRCm39) N484S probably benign Het
Tenm3 A T 8: 48,693,431 (GRCm39) M1833K possibly damaging Het
Thoc5 A G 11: 4,871,922 (GRCm39) E449G probably benign Het
Usp34 A G 11: 23,396,464 (GRCm39) probably null Het
Other mutations in Mybphl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03365:Mybphl APN 3 108,272,314 (GRCm39) start codon destroyed probably null 0.98
IGL03389:Mybphl APN 3 108,283,034 (GRCm39) missense probably benign 0.09
R0194:Mybphl UTSW 3 108,281,484 (GRCm39) missense probably benign 0.01
R0206:Mybphl UTSW 3 108,282,731 (GRCm39) missense probably damaging 1.00
R0206:Mybphl UTSW 3 108,282,731 (GRCm39) missense probably damaging 1.00
R0208:Mybphl UTSW 3 108,282,731 (GRCm39) missense probably damaging 1.00
R1067:Mybphl UTSW 3 108,272,319 (GRCm39) missense probably benign
R1748:Mybphl UTSW 3 108,282,400 (GRCm39) critical splice acceptor site probably null
R2013:Mybphl UTSW 3 108,282,718 (GRCm39) missense probably benign 0.02
R2102:Mybphl UTSW 3 108,282,949 (GRCm39) missense possibly damaging 0.82
R2121:Mybphl UTSW 3 108,282,492 (GRCm39) missense probably damaging 1.00
R2197:Mybphl UTSW 3 108,284,635 (GRCm39) missense probably damaging 1.00
R2265:Mybphl UTSW 3 108,272,317 (GRCm39) missense probably damaging 1.00
R2266:Mybphl UTSW 3 108,272,317 (GRCm39) missense probably damaging 1.00
R2267:Mybphl UTSW 3 108,272,317 (GRCm39) missense probably damaging 1.00
R2268:Mybphl UTSW 3 108,272,317 (GRCm39) missense probably damaging 1.00
R4551:Mybphl UTSW 3 108,281,479 (GRCm39) missense possibly damaging 0.49
R4570:Mybphl UTSW 3 108,272,347 (GRCm39) missense possibly damaging 0.61
R4693:Mybphl UTSW 3 108,282,494 (GRCm39) missense probably benign 0.01
R5759:Mybphl UTSW 3 108,282,070 (GRCm39) missense probably benign 0.30
R7017:Mybphl UTSW 3 108,282,154 (GRCm39) missense probably damaging 0.99
R7526:Mybphl UTSW 3 108,281,496 (GRCm39) missense probably benign 0.00
R8266:Mybphl UTSW 3 108,284,676 (GRCm39) missense probably damaging 1.00
R8976:Mybphl UTSW 3 108,272,334 (GRCm39) missense probably damaging 1.00
R9440:Mybphl UTSW 3 108,282,202 (GRCm39) missense probably benign 0.19
R9617:Mybphl UTSW 3 108,282,952 (GRCm39) missense possibly damaging 0.68
R9655:Mybphl UTSW 3 108,282,099 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGACACGGTGGTAGGTGATG -3'
(R):5'- TGGTAACGCTCCAGGACTGTGAAC -3'

Sequencing Primer
(F):5'- GTATTCTGTAGTGAGGTTGCCAC -3'
(R):5'- ACATGGAGCTGCCAGAAGAT -3'
Posted On 2014-01-29