Mutagenetix > Incidental Mutation

Incidental Mutation 'R1223:Mybphl'

152790

Institutional Source

Beutler Lab

Gene Symbol

Mybphl

Ensembl Gene

ENSMUSG00000068745

Gene Name

myosin binding protein H-like

Synonyms

MMRRC Submission

039292-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R1223 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108364911-108380057 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108375196 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 182 (T182A)

Ref Sequence

ENSEMBL: ENSMUSP00000088051 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090563]

AlphaFold

Q5FW53

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090563
AA Change: T182A

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000088051
Gene: ENSMUSG00000068745
AA Change: T182A

Domain	Start	End	E-Value	Type
IG	61	144	4.67e-4	SMART
FN3	147	229	1.62e-10	SMART
IG	268	352	3.68e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142833

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 89.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two immunoglobulin superfamily domains and a fibronectin 3 domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy9	A	T	16: 4,298,748	V873E	probably damaging	Het
Arl10	A	G	13: 54,578,931	D174G	probably damaging	Het
Cd180	A	T	13: 102,706,222	Y592F	possibly damaging	Het
Ces3a	A	T	8: 105,058,029	T548S	probably benign	Het
Chd2	T	C	7: 73,484,517	E694G	probably damaging	Het
Commd3	T	C	2: 18,674,968	Y163H	probably benign	Het
Cyp8b1	A	G	9: 121,915,004	S421P	possibly damaging	Het
Cysltr2	A	T	14: 73,030,099	V57E	probably damaging	Het
D430042O09Rik	T	A	7: 125,760,423	V62E	possibly damaging	Het
Ddx47	G	A	6: 135,012,314	V34I	possibly damaging	Het
Dgkz	T	C	2: 91,939,315		probably benign	Het
Dsg2	G	T	18: 20,573,493	C22F	probably benign	Het
Gbp10	A	C	5: 105,219,001	V455G	probably damaging	Het
Gm12185	T	A	11: 48,907,276	I797F	probably damaging	Het
Lrrk2	A	G	15: 91,673,635	E58G	probably benign	Het
Mrgprb1	A	G	7: 48,447,687	V159A	possibly damaging	Het
Olfr1154	G	A	2: 87,902,819	P286S	probably damaging	Het
Olfr676	A	T	7: 105,035,566	I123F	probably benign	Het
Osr1	C	T	12: 9,579,699	L191F	probably damaging	Het
Pip4k2b	G	A	11: 97,718,894	R406C	probably damaging	Het
Plce1	C	T	19: 38,702,013	L714F	probably damaging	Het
Plce1	T	C	19: 38,767,226	F1886S	probably damaging	Het
Ppp1cc	A	G	5: 122,168,214	E32G	probably damaging	Het
Rnh1	A	G	7: 141,163,207	L260P	probably damaging	Het
Serpinb3a	T	A	1: 107,047,552	N175I	probably damaging	Het
Sptbn5	T	A	2: 120,072,044	I68F	probably damaging	Het
Tas1r2	A	T	4: 139,660,204	T325S	probably damaging	Het
Tcirg1	T	C	19: 3,898,733	N484S	probably benign	Het
Tenm3	A	T	8: 48,240,396	M1833K	possibly damaging	Het
Thoc5	A	G	11: 4,921,922	E449G	probably benign	Het
Usp34	A	G	11: 23,446,464		probably null	Het

Other mutations in Mybphl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03365:Mybphl	APN	3	108364998	start codon destroyed	probably null	0.98
IGL03389:Mybphl	APN	3	108375718	missense	probably benign	0.09
R0194:Mybphl	UTSW	3	108374168	missense	probably benign	0.01
R0206:Mybphl	UTSW	3	108375415	missense	probably damaging	1.00
R0206:Mybphl	UTSW	3	108375415	missense	probably damaging	1.00
R0208:Mybphl	UTSW	3	108375415	missense	probably damaging	1.00
R1067:Mybphl	UTSW	3	108365003	missense	probably benign
R1748:Mybphl	UTSW	3	108375084	critical splice acceptor site	probably null
R2013:Mybphl	UTSW	3	108375402	missense	probably benign	0.02
R2102:Mybphl	UTSW	3	108375633	missense	possibly damaging	0.82
R2121:Mybphl	UTSW	3	108375176	missense	probably damaging	1.00
R2197:Mybphl	UTSW	3	108377319	missense	probably damaging	1.00
R2265:Mybphl	UTSW	3	108365001	missense	probably damaging	1.00
R2266:Mybphl	UTSW	3	108365001	missense	probably damaging	1.00
R2267:Mybphl	UTSW	3	108365001	missense	probably damaging	1.00
R2268:Mybphl	UTSW	3	108365001	missense	probably damaging	1.00
R4551:Mybphl	UTSW	3	108374163	missense	possibly damaging	0.49
R4570:Mybphl	UTSW	3	108365031	missense	possibly damaging	0.61
R4693:Mybphl	UTSW	3	108375178	missense	probably benign	0.01
R5759:Mybphl	UTSW	3	108374754	missense	probably benign	0.30
R7017:Mybphl	UTSW	3	108374838	missense	probably damaging	0.99
R7526:Mybphl	UTSW	3	108374180	missense	probably benign	0.00
R8266:Mybphl	UTSW	3	108377360	missense	probably damaging	1.00
R8976:Mybphl	UTSW	3	108365018	missense	probably damaging	1.00
R9440:Mybphl	UTSW	3	108374886	missense	probably benign	0.19
R9617:Mybphl	UTSW	3	108375636	missense	possibly damaging	0.68
R9655:Mybphl	UTSW	3	108374783	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCAGACACGGTGGTAGGTGATG -3'
(R):5'- TGGTAACGCTCCAGGACTGTGAAC -3'

Sequencing Primer
(F):5'- GTATTCTGTAGTGAGGTTGCCAC -3'
(R):5'- ACATGGAGCTGCCAGAAGAT -3'

Posted On

2014-01-29