Incidental Mutation 'R1223:Tas1r2'
ID 152792
Institutional Source Beutler Lab
Gene Symbol Tas1r2
Ensembl Gene ENSMUSG00000028738
Gene Name taste receptor, type 1, member 2
Synonyms Gpr71, TR2, T1r2
MMRRC Submission 039292-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R1223 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 139653538-139670280 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 139660204 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 325 (T325S)
Ref Sequence ENSEMBL: ENSMUSP00000030510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030510] [ENSMUST00000166773] [ENSMUST00000178644]
AlphaFold Q925I4
Predicted Effect probably damaging
Transcript: ENSMUST00000030510
AA Change: T325S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030510
Gene: ENSMUSG00000028738
AA Change: T325S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 73 459 2e-90 PFAM
Pfam:NCD3G 495 548 2.4e-17 PFAM
Pfam:7tm_3 581 818 2.8e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166773
AA Change: T296S

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127737
Gene: ENSMUSG00000028738
AA Change: T296S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 73 213 5.3e-38 PFAM
Pfam:ANF_receptor 217 429 8.4e-31 PFAM
Pfam:NCD3G 466 519 7.4e-19 PFAM
Pfam:7tm_3 550 790 3e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178644
SMART Domains Protein: ENSMUSP00000136776
Gene: ENSMUSG00000094439

DomainStartEndE-ValueType
SCOP:d1lbva_ 1 60 5e-3 SMART
Pfam:Filament 165 253 7.3e-13 PFAM
low complexity region 255 268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice show diminished behavioral and nervous responses to sweet tastants. Response to umami tastants is unimpaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A T 16: 4,298,748 V873E probably damaging Het
Arl10 A G 13: 54,578,931 D174G probably damaging Het
Cd180 A T 13: 102,706,222 Y592F possibly damaging Het
Ces3a A T 8: 105,058,029 T548S probably benign Het
Chd2 T C 7: 73,484,517 E694G probably damaging Het
Commd3 T C 2: 18,674,968 Y163H probably benign Het
Cyp8b1 A G 9: 121,915,004 S421P possibly damaging Het
Cysltr2 A T 14: 73,030,099 V57E probably damaging Het
D430042O09Rik T A 7: 125,760,423 V62E possibly damaging Het
Ddx47 G A 6: 135,012,314 V34I possibly damaging Het
Dgkz T C 2: 91,939,315 probably benign Het
Dsg2 G T 18: 20,573,493 C22F probably benign Het
Gbp10 A C 5: 105,219,001 V455G probably damaging Het
Gm12185 T A 11: 48,907,276 I797F probably damaging Het
Lrrk2 A G 15: 91,673,635 E58G probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mybphl A G 3: 108,375,196 T182A possibly damaging Het
Olfr1154 G A 2: 87,902,819 P286S probably damaging Het
Olfr676 A T 7: 105,035,566 I123F probably benign Het
Osr1 C T 12: 9,579,699 L191F probably damaging Het
Pip4k2b G A 11: 97,718,894 R406C probably damaging Het
Plce1 C T 19: 38,702,013 L714F probably damaging Het
Plce1 T C 19: 38,767,226 F1886S probably damaging Het
Ppp1cc A G 5: 122,168,214 E32G probably damaging Het
Rnh1 A G 7: 141,163,207 L260P probably damaging Het
Serpinb3a T A 1: 107,047,552 N175I probably damaging Het
Sptbn5 T A 2: 120,072,044 I68F probably damaging Het
Tcirg1 T C 19: 3,898,733 N484S probably benign Het
Tenm3 A T 8: 48,240,396 M1833K possibly damaging Het
Thoc5 A G 11: 4,921,922 E449G probably benign Het
Usp34 A G 11: 23,446,464 probably null Het
Other mutations in Tas1r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Tas1r2 APN 4 139660291 missense probably benign 0.03
IGL00952:Tas1r2 APN 4 139655252 missense probably benign 0.00
IGL00972:Tas1r2 APN 4 139660036 missense probably damaging 0.99
IGL01939:Tas1r2 APN 4 139669177 missense probably damaging 1.00
IGL02247:Tas1r2 APN 4 139669516 missense probably damaging 1.00
IGL02663:Tas1r2 APN 4 139660282 missense probably benign
IGL03155:Tas1r2 APN 4 139669156 missense possibly damaging 0.95
R0395:Tas1r2 UTSW 4 139655354 missense possibly damaging 0.86
R0798:Tas1r2 UTSW 4 139669713 missense probably damaging 1.00
R1221:Tas1r2 UTSW 4 139669125 missense probably benign 0.00
R1261:Tas1r2 UTSW 4 139655288 missense probably damaging 0.99
R1262:Tas1r2 UTSW 4 139655288 missense probably damaging 0.99
R1330:Tas1r2 UTSW 4 139669329 missense probably benign 0.05
R1466:Tas1r2 UTSW 4 139669411 missense probably damaging 1.00
R1466:Tas1r2 UTSW 4 139669411 missense probably damaging 1.00
R1879:Tas1r2 UTSW 4 139669695 missense probably damaging 1.00
R2112:Tas1r2 UTSW 4 139655355 missense probably benign 0.00
R2156:Tas1r2 UTSW 4 139669041 missense possibly damaging 0.79
R2509:Tas1r2 UTSW 4 139659851 missense probably damaging 1.00
R2510:Tas1r2 UTSW 4 139659851 missense probably damaging 1.00
R2511:Tas1r2 UTSW 4 139659851 missense probably damaging 1.00
R3429:Tas1r2 UTSW 4 139669575 missense probably damaging 1.00
R3430:Tas1r2 UTSW 4 139669575 missense probably damaging 1.00
R3703:Tas1r2 UTSW 4 139667418 missense probably damaging 1.00
R4105:Tas1r2 UTSW 4 139660052 missense probably benign 0.06
R4106:Tas1r2 UTSW 4 139660052 missense probably benign 0.06
R4107:Tas1r2 UTSW 4 139660052 missense probably benign 0.06
R4614:Tas1r2 UTSW 4 139659787 missense probably damaging 1.00
R4811:Tas1r2 UTSW 4 139669000 missense probably damaging 1.00
R5314:Tas1r2 UTSW 4 139655361 missense probably damaging 1.00
R5461:Tas1r2 UTSW 4 139660009 missense probably benign 0.01
R5639:Tas1r2 UTSW 4 139659796 missense probably damaging 1.00
R5703:Tas1r2 UTSW 4 139667336 missense probably damaging 1.00
R6176:Tas1r2 UTSW 4 139668888 missense probably damaging 1.00
R6297:Tas1r2 UTSW 4 139662050 missense possibly damaging 0.47
R6441:Tas1r2 UTSW 4 139669156 missense probably damaging 0.99
R6748:Tas1r2 UTSW 4 139669611 missense probably damaging 0.98
R6863:Tas1r2 UTSW 4 139669719 missense probably damaging 1.00
R6975:Tas1r2 UTSW 4 139669720 missense probably damaging 1.00
R7106:Tas1r2 UTSW 4 139662049 missense probably benign
R7265:Tas1r2 UTSW 4 139669652 missense probably benign 0.01
R7580:Tas1r2 UTSW 4 139659745 missense probably benign 0.05
R7651:Tas1r2 UTSW 4 139669627 missense probably benign 0.14
R8041:Tas1r2 UTSW 4 139659979 missense possibly damaging 0.65
R8530:Tas1r2 UTSW 4 139662149 missense probably benign
R8747:Tas1r2 UTSW 4 139660007 missense probably benign
R8824:Tas1r2 UTSW 4 139653763 splice site probably benign
R8904:Tas1r2 UTSW 4 139667403 missense probably damaging 1.00
R8906:Tas1r2 UTSW 4 139669735 missense probably damaging 1.00
R9315:Tas1r2 UTSW 4 139653735 missense possibly damaging 0.91
R9336:Tas1r2 UTSW 4 139662005 missense probably damaging 1.00
R9419:Tas1r2 UTSW 4 139659725 missense possibly damaging 0.65
R9776:Tas1r2 UTSW 4 139668897 missense possibly damaging 0.68
Z1088:Tas1r2 UTSW 4 139660424 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GATTATGGCCGAGAGAACAGCCAC -3'
(R):5'- TGATGTTCATGCAGGCGTCACAG -3'

Sequencing Primer
(F):5'- CAACACTGGCGATATCTGCATTG -3'
(R):5'- CACAGTCCTGGTTACAGGTAG -3'
Posted On 2014-01-29