Mutagenetix > Incidental Mutation

Incidental Mutation 'R1223:Chd2'

152800

Institutional Source

Beutler Lab

Gene Symbol

Chd2

Ensembl Gene

ENSMUSG00000078671

Gene Name

chromodomain helicase DNA binding protein 2

Synonyms

5630401D06Rik, 2810013C04Rik, 2810040A01Rik

MMRRC Submission

039292-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.578) question?

Stock #

R1223 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73076400-73191494 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 73134265 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 694 (E694G)

Ref Sequence

ENSEMBL: ENSMUSP00000126352 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169922]

AlphaFold

E9PZM4

Predicted Effect

probably damaging
Transcript: ENSMUST00000169922
AA Change: E694G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671
AA Change: E694G

Domain	Start	End	E-Value	Type
low complexity region	13	75	N/A	INTRINSIC
low complexity region	80	91	N/A	INTRINSIC
low complexity region	126	136	N/A	INTRINSIC
low complexity region	176	196	N/A	INTRINSIC
low complexity region	235	244	N/A	INTRINSIC
CHROMO	260	346	3.64e-19	SMART
CHROMO	376	449	7.99e-16	SMART
DEXDc	480	677	1.93e-37	SMART
Blast:DEXDc	678	729	2e-18	BLAST
low complexity region	793	806	N/A	INTRINSIC
HELICc	821	905	1.2e-24	SMART
Blast:DEXDc	960	1244	4e-63	BLAST
PDB:4B4C\|A	1128	1316	5e-78	PDB
low complexity region	1317	1329	N/A	INTRINSIC
low complexity region	1338	1351	N/A	INTRINSIC
low complexity region	1389	1403	N/A	INTRINSIC
low complexity region	1407	1441	N/A	INTRINSIC
DUF4208	1451	1555	1.85e-52	SMART
low complexity region	1557	1572	N/A	INTRINSIC
low complexity region	1704	1729	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199831

Predicted Effect

probably benign
Transcript: ENSMUST00000200423

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 89.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early postnatal lethality associated with fetal growth retardation. Mice heterozygous for a gene trap allele exhibit postnatal lethality and premature death after weaning associated with growth retardation and multi-organ defects. [provided by MGI curators]

Allele List at MGI

All alleles(169) : Targeted, knock-out(1) Gene trapped(168)

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy9	A	T	16: 4,116,612 (GRCm39)	V873E	probably damaging	Het
Arl10	A	G	13: 54,726,744 (GRCm39)	D174G	probably damaging	Het
Cd180	A	T	13: 102,842,730 (GRCm39)	Y592F	possibly damaging	Het
Ces3a	A	T	8: 105,784,661 (GRCm39)	T548S	probably benign	Het
Commd3	T	C	2: 18,679,779 (GRCm39)	Y163H	probably benign	Het
Cyp8b1	A	G	9: 121,744,070 (GRCm39)	S421P	possibly damaging	Het
Cysltr2	A	T	14: 73,267,539 (GRCm39)	V57E	probably damaging	Het
Ddx47	G	A	6: 134,989,277 (GRCm39)	V34I	possibly damaging	Het
Dgkz	T	C	2: 91,769,660 (GRCm39)		probably benign	Het
Dsg2	G	T	18: 20,706,550 (GRCm39)	C22F	probably benign	Het
Gbp10	A	C	5: 105,366,867 (GRCm39)	V455G	probably damaging	Het
Gm12185	T	A	11: 48,798,103 (GRCm39)	I797F	probably damaging	Het
Katnip	T	A	7: 125,359,595 (GRCm39)	V62E	possibly damaging	Het
Lrrk2	A	G	15: 91,557,838 (GRCm39)	E58G	probably benign	Het
Mrgprb1	A	G	7: 48,097,435 (GRCm39)	V159A	possibly damaging	Het
Mybphl	A	G	3: 108,282,512 (GRCm39)	T182A	possibly damaging	Het
Or52e7	A	T	7: 104,684,773 (GRCm39)	I123F	probably benign	Het
Or9m1	G	A	2: 87,733,163 (GRCm39)	P286S	probably damaging	Het
Osr1	C	T	12: 9,629,699 (GRCm39)	L191F	probably damaging	Het
Pip4k2b	G	A	11: 97,609,720 (GRCm39)	R406C	probably damaging	Het
Plce1	C	T	19: 38,690,457 (GRCm39)	L714F	probably damaging	Het
Plce1	T	C	19: 38,755,670 (GRCm39)	F1886S	probably damaging	Het
Ppp1cc	A	G	5: 122,306,277 (GRCm39)	E32G	probably damaging	Het
Rnh1	A	G	7: 140,743,120 (GRCm39)	L260P	probably damaging	Het
Serpinb3a	T	A	1: 106,975,282 (GRCm39)	N175I	probably damaging	Het
Sptbn5	T	A	2: 119,902,525 (GRCm39)	I68F	probably damaging	Het
Tas1r2	A	T	4: 139,387,515 (GRCm39)	T325S	probably damaging	Het
Tcirg1	T	C	19: 3,948,733 (GRCm39)	N484S	probably benign	Het
Tenm3	A	T	8: 48,693,431 (GRCm39)	M1833K	possibly damaging	Het
Thoc5	A	G	11: 4,871,922 (GRCm39)	E449G	probably benign	Het
Usp34	A	G	11: 23,396,464 (GRCm39)		probably null	Het

Other mutations in Chd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Chd2	APN	7	73,118,325 (GRCm39)	missense	probably damaging	0.99
IGL00535:Chd2	APN	7	73,190,576 (GRCm39)	missense	probably benign	0.01
IGL00961:Chd2	APN	7	73,093,997 (GRCm39)	missense	probably damaging	0.99
IGL01092:Chd2	APN	7	73,091,434 (GRCm39)	missense	possibly damaging	0.69
IGL02035:Chd2	APN	7	73,091,375 (GRCm39)	splice site	probably null
IGL02083:Chd2	APN	7	73,130,816 (GRCm39)	missense	possibly damaging	0.95
IGL02205:Chd2	APN	7	73,091,465 (GRCm39)	missense	probably benign	0.01
IGL02243:Chd2	APN	7	73,147,456 (GRCm39)	splice site	probably null
IGL02385:Chd2	APN	7	73,085,570 (GRCm39)	missense	probably damaging	1.00
IGL02552:Chd2	APN	7	73,097,068 (GRCm39)	unclassified	probably benign
IGL02590:Chd2	APN	7	73,102,948 (GRCm39)	missense	probably benign	0.00
IGL02684:Chd2	APN	7	73,125,097 (GRCm39)	missense	probably damaging	0.99
IGL02731:Chd2	APN	7	73,143,204 (GRCm39)	missense	probably damaging	0.99
IGL03272:Chd2	APN	7	73,102,914 (GRCm39)	missense	possibly damaging	0.94
1mM(1):Chd2	UTSW	7	73,151,852 (GRCm39)	missense	possibly damaging	0.65
A4554:Chd2	UTSW	7	73,130,716 (GRCm39)	missense	probably benign
F6893:Chd2	UTSW	7	73,157,620 (GRCm39)	missense	possibly damaging	0.92
R0012:Chd2	UTSW	7	73,105,267 (GRCm39)	missense	probably damaging	1.00
R0012:Chd2	UTSW	7	73,105,267 (GRCm39)	missense	probably damaging	1.00
R0068:Chd2	UTSW	7	73,134,282 (GRCm39)	missense	probably damaging	1.00
R0763:Chd2	UTSW	7	73,097,022 (GRCm39)	missense	possibly damaging	0.74
R0973:Chd2	UTSW	7	73,128,412 (GRCm39)	missense	probably damaging	1.00
R0973:Chd2	UTSW	7	73,128,412 (GRCm39)	missense	probably damaging	1.00
R0974:Chd2	UTSW	7	73,128,412 (GRCm39)	missense	probably damaging	1.00
R1435:Chd2	UTSW	7	73,102,884 (GRCm39)	missense	probably damaging	0.99
R1527:Chd2	UTSW	7	73,140,362 (GRCm39)	nonsense	probably null
R1599:Chd2	UTSW	7	73,122,799 (GRCm39)	missense	probably benign	0.05
R1657:Chd2	UTSW	7	73,130,178 (GRCm39)	missense	probably damaging	1.00
R1932:Chd2	UTSW	7	73,104,193 (GRCm39)	missense	probably damaging	0.99
R2110:Chd2	UTSW	7	73,079,735 (GRCm39)	missense	probably benign	0.00
R2202:Chd2	UTSW	7	73,128,416 (GRCm39)	missense	probably benign	0.00
R2383:Chd2	UTSW	7	73,153,168 (GRCm39)	missense	possibly damaging	0.89
R2393:Chd2	UTSW	7	73,157,631 (GRCm39)	missense	possibly damaging	0.92
R3699:Chd2	UTSW	7	73,118,238 (GRCm39)	missense	probably benign	0.35
R3713:Chd2	UTSW	7	73,121,538 (GRCm39)	unclassified	probably benign
R3788:Chd2	UTSW	7	73,096,878 (GRCm39)	unclassified	probably benign
R3826:Chd2	UTSW	7	73,141,163 (GRCm39)	missense	possibly damaging	0.71
R3828:Chd2	UTSW	7	73,141,163 (GRCm39)	missense	possibly damaging	0.71
R3830:Chd2	UTSW	7	73,141,163 (GRCm39)	missense	possibly damaging	0.71
R3966:Chd2	UTSW	7	73,114,143 (GRCm39)	splice site	probably benign
R4093:Chd2	UTSW	7	73,150,764 (GRCm39)	missense	possibly damaging	0.70
R4431:Chd2	UTSW	7	73,085,709 (GRCm39)	missense	possibly damaging	0.56
R4461:Chd2	UTSW	7	73,190,622 (GRCm39)	intron	probably benign
R4782:Chd2	UTSW	7	73,134,184 (GRCm39)	missense	possibly damaging	0.80
R4791:Chd2	UTSW	7	73,118,325 (GRCm39)	missense	probably benign	0.13
R4792:Chd2	UTSW	7	73,118,325 (GRCm39)	missense	probably benign	0.13
R4799:Chd2	UTSW	7	73,134,184 (GRCm39)	missense	possibly damaging	0.80
R4832:Chd2	UTSW	7	73,151,873 (GRCm39)	missense	probably damaging	1.00
R5055:Chd2	UTSW	7	73,130,256 (GRCm39)	missense	probably damaging	1.00
R5071:Chd2	UTSW	7	73,079,437 (GRCm39)	missense	probably benign	0.03
R5328:Chd2	UTSW	7	73,113,429 (GRCm39)	missense	possibly damaging	0.96
R5444:Chd2	UTSW	7	73,122,833 (GRCm39)	missense	probably damaging	1.00
R5643:Chd2	UTSW	7	73,134,232 (GRCm39)	missense	probably damaging	1.00
R5666:Chd2	UTSW	7	73,091,465 (GRCm39)	missense	probably benign	0.01
R5670:Chd2	UTSW	7	73,091,465 (GRCm39)	missense	probably benign	0.01
R5706:Chd2	UTSW	7	73,141,105 (GRCm39)	missense	possibly damaging	0.74
R5825:Chd2	UTSW	7	73,134,350 (GRCm39)	splice site	probably null
R5834:Chd2	UTSW	7	73,128,463 (GRCm39)	missense	probably damaging	1.00
R5920:Chd2	UTSW	7	73,187,060 (GRCm39)	missense	probably damaging	0.97
R6051:Chd2	UTSW	7	73,085,590 (GRCm39)	missense	probably benign	0.00
R6179:Chd2	UTSW	7	73,094,071 (GRCm39)	missense	probably damaging	0.98
R6229:Chd2	UTSW	7	73,101,471 (GRCm39)	missense	possibly damaging	0.76
R6267:Chd2	UTSW	7	73,113,419 (GRCm39)	missense	probably damaging	0.99
R6310:Chd2	UTSW	7	73,102,912 (GRCm39)	missense	probably damaging	1.00
R6439:Chd2	UTSW	7	73,130,154 (GRCm39)	missense	probably damaging	1.00
R6444:Chd2	UTSW	7	73,150,785 (GRCm39)	critical splice acceptor site	probably null
R6529:Chd2	UTSW	7	73,153,191 (GRCm39)	missense	possibly damaging	0.89
R6611:Chd2	UTSW	7	73,143,313 (GRCm39)	missense	probably damaging	0.99
R6661:Chd2	UTSW	7	73,140,230 (GRCm39)	missense	possibly damaging	0.95
R6782:Chd2	UTSW	7	73,125,127 (GRCm39)	nonsense	probably null
R6860:Chd2	UTSW	7	73,147,558 (GRCm39)	missense	possibly damaging	0.95
R6955:Chd2	UTSW	7	73,125,171 (GRCm39)	missense	probably damaging	1.00
R6984:Chd2	UTSW	7	73,134,159 (GRCm39)	nonsense	probably null
R7095:Chd2	UTSW	7	73,121,629 (GRCm39)	missense	probably damaging	1.00
R7121:Chd2	UTSW	7	73,119,418 (GRCm39)	missense	probably benign	0.00
R7179:Chd2	UTSW	7	73,125,168 (GRCm39)	missense	probably damaging	1.00
R7500:Chd2	UTSW	7	73,101,556 (GRCm39)	missense	probably damaging	1.00
R7615:Chd2	UTSW	7	73,091,390 (GRCm39)	missense	probably damaging	0.97
R7646:Chd2	UTSW	7	73,085,521 (GRCm39)	missense	possibly damaging	0.49
R7764:Chd2	UTSW	7	73,121,567 (GRCm39)	missense	probably null	1.00
R7898:Chd2	UTSW	7	73,169,223 (GRCm39)	critical splice donor site	probably null
R7935:Chd2	UTSW	7	73,149,373 (GRCm39)	missense	probably benign	0.01
R8033:Chd2	UTSW	7	73,085,628 (GRCm39)	missense	probably damaging	1.00
R8070:Chd2	UTSW	7	73,101,506 (GRCm39)	missense	probably benign
R8071:Chd2	UTSW	7	73,187,132 (GRCm39)	missense	probably benign
R8188:Chd2	UTSW	7	73,079,504 (GRCm39)	nonsense	probably null
R8196:Chd2	UTSW	7	73,118,285 (GRCm39)	missense	probably benign	0.00
R8258:Chd2	UTSW	7	73,085,532 (GRCm39)	missense	probably benign	0.11
R8259:Chd2	UTSW	7	73,085,532 (GRCm39)	missense	probably benign	0.11
R8357:Chd2	UTSW	7	73,096,985 (GRCm39)	missense	probably damaging	0.99
R8457:Chd2	UTSW	7	73,096,985 (GRCm39)	missense	probably damaging	0.99
R8778:Chd2	UTSW	7	73,079,483 (GRCm39)	missense	possibly damaging	0.88
R8816:Chd2	UTSW	7	73,140,245 (GRCm39)	missense	probably damaging	1.00
R8875:Chd2	UTSW	7	73,151,783 (GRCm39)	missense	probably damaging	1.00
R8935:Chd2	UTSW	7	73,153,210 (GRCm39)	missense	possibly damaging	0.47
R9005:Chd2	UTSW	7	73,134,294 (GRCm39)	missense	probably damaging	0.98
R9009:Chd2	UTSW	7	73,143,192 (GRCm39)	missense	probably benign	0.39
R9009:Chd2	UTSW	7	73,140,402 (GRCm39)	missense	probably benign	0.12
R9021:Chd2	UTSW	7	73,091,393 (GRCm39)	missense	probably benign	0.03
R9038:Chd2	UTSW	7	73,105,358 (GRCm39)	missense	probably damaging	1.00
R9064:Chd2	UTSW	7	73,143,279 (GRCm39)	missense	possibly damaging	0.70
R9383:Chd2	UTSW	7	73,098,918 (GRCm39)	missense	probably null	1.00
R9501:Chd2	UTSW	7	73,130,294 (GRCm39)	missense	probably damaging	1.00
R9501:Chd2	UTSW	7	73,091,481 (GRCm39)	missense	possibly damaging	0.92
R9550:Chd2	UTSW	7	73,119,439 (GRCm39)	missense	probably damaging	0.99
R9583:Chd2	UTSW	7	73,130,230 (GRCm39)	missense	probably damaging	0.99
R9665:Chd2	UTSW	7	73,079,555 (GRCm39)	missense	probably benign	0.00
RF009:Chd2	UTSW	7	73,169,410 (GRCm39)	missense	possibly damaging	0.73
X0025:Chd2	UTSW	7	73,157,585 (GRCm39)	missense	probably benign	0.11
Z1177:Chd2	UTSW	7	73,118,334 (GRCm39)	missense	possibly damaging	0.48

Predicted Primers

PCR Primer
(F):5'- CTCTGTGGTCTCTAGCAAGCCAAG -3'
(R):5'- CAGTGATGGGCAAAATTGGCCTTTC -3'

Sequencing Primer
(F):5'- ggaagagagagggggagg -3'
(R):5'- AAAATTGGCCTTTCCTGGCAG -3'

Posted On

2014-01-29