Incidental Mutation 'R1223:Rnh1'
ID 152803
Institutional Source Beutler Lab
Gene Symbol Rnh1
Ensembl Gene ENSMUSG00000038650
Gene Name ribonuclease/angiogenin inhibitor 1
Synonyms RNH
MMRRC Submission 039292-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R1223 (G1)
Quality Score 82
Status Not validated
Chromosome 7
Chromosomal Location 141160326-141172857 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 141163207 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 260 (L260P)
Ref Sequence ENSEMBL: ENSMUSP00000147928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106033] [ENSMUST00000167493] [ENSMUST00000209378] [ENSMUST00000210314] [ENSMUST00000210979]
AlphaFold Q91VI7
Predicted Effect probably damaging
Transcript: ENSMUST00000106033
AA Change: L224P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101651
Gene: ENSMUSG00000038650
AA Change: L224P

DomainStartEndE-ValueType
Blast:LRR 22 49 3e-7 BLAST
LRR 50 77 2.95e-3 SMART
LRR 79 106 1.95e-3 SMART
LRR_RI 107 134 1.36e-7 SMART
LRR 136 163 7.15e-2 SMART
LRR 164 191 2.65e-5 SMART
LRR 193 220 4.24e-1 SMART
LRR 221 248 4.94e-5 SMART
LRR 250 277 2.34e-6 SMART
LRR 278 305 1.15e-5 SMART
LRR 307 334 8e0 SMART
LRR 335 362 4.75e-7 SMART
LRR 364 391 1.12e-3 SMART
LRR 392 419 6.17e-6 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167493
AA Change: L224P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133061
Gene: ENSMUSG00000038650
AA Change: L224P

DomainStartEndE-ValueType
Blast:LRR 22 49 3e-7 BLAST
LRR 50 77 2.95e-3 SMART
LRR 79 106 1.95e-3 SMART
LRR_RI 107 134 1.36e-7 SMART
LRR 136 163 7.15e-2 SMART
LRR 164 191 2.65e-5 SMART
LRR 193 220 4.24e-1 SMART
LRR 221 248 4.94e-5 SMART
LRR 250 277 2.34e-6 SMART
LRR 278 305 1.15e-5 SMART
LRR 307 334 8e0 SMART
LRR 335 362 4.75e-7 SMART
LRR 364 391 1.12e-3 SMART
LRR 392 419 6.17e-6 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209378
Predicted Effect probably damaging
Transcript: ENSMUST00000210314
AA Change: L260P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210979
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Placental ribonuclease inhibitor (PRI) is a member of a family of proteinaceous cytoplasmic RNase inhibitors that occur in many tissues and bind to both intracellular and extracellular RNases (summarized by Lee et al., 1988 [PubMed 3219362]). In addition to control of intracellular RNases, the inhibitor may have a role in the regulation of angiogenin (MIM 105850). Ribonuclease inhibitor, of 50,000 Da, binds to ribonucleases and holds them in a latent form. Since neutral and alkaline ribonucleases probably play a critical role in the turnover of RNA in eukaryotic cells, RNH may be essential for control of mRNA turnover; the interaction of eukaryotic cells with ribonuclease may be reversible in vivo.[supplied by OMIM, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A T 16: 4,298,748 V873E probably damaging Het
Arl10 A G 13: 54,578,931 D174G probably damaging Het
Cd180 A T 13: 102,706,222 Y592F possibly damaging Het
Ces3a A T 8: 105,058,029 T548S probably benign Het
Chd2 T C 7: 73,484,517 E694G probably damaging Het
Commd3 T C 2: 18,674,968 Y163H probably benign Het
Cyp8b1 A G 9: 121,915,004 S421P possibly damaging Het
Cysltr2 A T 14: 73,030,099 V57E probably damaging Het
D430042O09Rik T A 7: 125,760,423 V62E possibly damaging Het
Ddx47 G A 6: 135,012,314 V34I possibly damaging Het
Dgkz T C 2: 91,939,315 probably benign Het
Dsg2 G T 18: 20,573,493 C22F probably benign Het
Gbp10 A C 5: 105,219,001 V455G probably damaging Het
Gm12185 T A 11: 48,907,276 I797F probably damaging Het
Lrrk2 A G 15: 91,673,635 E58G probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mybphl A G 3: 108,375,196 T182A possibly damaging Het
Olfr1154 G A 2: 87,902,819 P286S probably damaging Het
Olfr676 A T 7: 105,035,566 I123F probably benign Het
Osr1 C T 12: 9,579,699 L191F probably damaging Het
Pip4k2b G A 11: 97,718,894 R406C probably damaging Het
Plce1 C T 19: 38,702,013 L714F probably damaging Het
Plce1 T C 19: 38,767,226 F1886S probably damaging Het
Ppp1cc A G 5: 122,168,214 E32G probably damaging Het
Serpinb3a T A 1: 107,047,552 N175I probably damaging Het
Sptbn5 T A 2: 120,072,044 I68F probably damaging Het
Tas1r2 A T 4: 139,660,204 T325S probably damaging Het
Tcirg1 T C 19: 3,898,733 N484S probably benign Het
Tenm3 A T 8: 48,240,396 M1833K possibly damaging Het
Thoc5 A G 11: 4,921,922 E449G probably benign Het
Usp34 A G 11: 23,446,464 probably null Het
Other mutations in Rnh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Rnh1 APN 7 141166731 missense possibly damaging 0.49
IGL01016:Rnh1 APN 7 141164496 splice site probably benign
IGL03156:Rnh1 APN 7 141163183 missense probably damaging 1.00
R0063:Rnh1 UTSW 7 141164196 splice site probably null
R0456:Rnh1 UTSW 7 141162548 missense possibly damaging 0.90
R1086:Rnh1 UTSW 7 141163369 missense probably benign
R1741:Rnh1 UTSW 7 141164023 missense probably benign 0.00
R1771:Rnh1 UTSW 7 141164606 missense possibly damaging 0.55
R4508:Rnh1 UTSW 7 141164543 missense possibly damaging 0.90
R5348:Rnh1 UTSW 7 141163408 missense probably damaging 0.99
R5581:Rnh1 UTSW 7 141163381 missense probably benign 0.00
R6752:Rnh1 UTSW 7 141163441 missense probably benign 0.00
R6932:Rnh1 UTSW 7 141163183 missense probably damaging 1.00
R7536:Rnh1 UTSW 7 141160812 missense possibly damaging 0.92
R8152:Rnh1 UTSW 7 141160704 missense probably damaging 1.00
R8334:Rnh1 UTSW 7 141168631 missense probably benign 0.01
R8791:Rnh1 UTSW 7 141162433 missense probably benign 0.40
R9018:Rnh1 UTSW 7 141168631 missense probably benign 0.01
R9248:Rnh1 UTSW 7 141160801 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGCAAGGCTGAGTTCCTTCAGGC -3'
(R):5'- ACAACGACCTCCATGAACCTGGTG -3'

Sequencing Primer
(F):5'- TGCTTGGCTCTGAGGACAC -3'
(R):5'- ATGAACCTGGTGTCCGTATTC -3'
Posted On 2014-01-29