Incidental Mutation 'R1223:Cyp8b1'
ID 152807
Institutional Source Beutler Lab
Gene Symbol Cyp8b1
Ensembl Gene ENSMUSG00000050445
Gene Name cytochrome P450, family 8, subfamily b, polypeptide 1
Synonyms sterol 12-alpha-hydrolase
MMRRC Submission 039292-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock # R1223 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 121914356-121916305 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121915004 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 421 (S421P)
Ref Sequence ENSEMBL: ENSMUSP00000052989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050327] [ENSMUST00000062474] [ENSMUST00000214340]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000050327
SMART Domains Protein: ENSMUSP00000050119
Gene: ENSMUSG00000044534

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
Pfam:7tm_1 62 311 1e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000062474
AA Change: S421P

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000052989
Gene: ENSMUSG00000050445
AA Change: S421P

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:p450 32 492 5.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214340
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the conversion of 7 alpha-hydroxy-4-cholesten-3-one into 7-alpha,12-alpha-dihydroxy-4-cholesten-3-one. The balance between these two steroids determines the relative amounts of cholic acid and chenodeoxycholic acid both of which are secreted in the bile and affect the solubility of cholesterol. This gene is unique among the cytochrome P450 genes in that it is intronless. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele lack synthsesis of cholate (a primary bile acid) and its metabolites and display an increased bile acid pool and alterations in cholesterol metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A T 16: 4,298,748 V873E probably damaging Het
Arl10 A G 13: 54,578,931 D174G probably damaging Het
Cd180 A T 13: 102,706,222 Y592F possibly damaging Het
Ces3a A T 8: 105,058,029 T548S probably benign Het
Chd2 T C 7: 73,484,517 E694G probably damaging Het
Commd3 T C 2: 18,674,968 Y163H probably benign Het
Cysltr2 A T 14: 73,030,099 V57E probably damaging Het
D430042O09Rik T A 7: 125,760,423 V62E possibly damaging Het
Ddx47 G A 6: 135,012,314 V34I possibly damaging Het
Dgkz T C 2: 91,939,315 probably benign Het
Dsg2 G T 18: 20,573,493 C22F probably benign Het
Gbp10 A C 5: 105,219,001 V455G probably damaging Het
Gm12185 T A 11: 48,907,276 I797F probably damaging Het
Lrrk2 A G 15: 91,673,635 E58G probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mybphl A G 3: 108,375,196 T182A possibly damaging Het
Olfr1154 G A 2: 87,902,819 P286S probably damaging Het
Olfr676 A T 7: 105,035,566 I123F probably benign Het
Osr1 C T 12: 9,579,699 L191F probably damaging Het
Pip4k2b G A 11: 97,718,894 R406C probably damaging Het
Plce1 C T 19: 38,702,013 L714F probably damaging Het
Plce1 T C 19: 38,767,226 F1886S probably damaging Het
Ppp1cc A G 5: 122,168,214 E32G probably damaging Het
Rnh1 A G 7: 141,163,207 L260P probably damaging Het
Serpinb3a T A 1: 107,047,552 N175I probably damaging Het
Sptbn5 T A 2: 120,072,044 I68F probably damaging Het
Tas1r2 A T 4: 139,660,204 T325S probably damaging Het
Tcirg1 T C 19: 3,898,733 N484S probably benign Het
Tenm3 A T 8: 48,240,396 M1833K possibly damaging Het
Thoc5 A G 11: 4,921,922 E449G probably benign Het
Usp34 A G 11: 23,446,464 probably null Het
Other mutations in Cyp8b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Cyp8b1 APN 9 121914995 missense probably damaging 0.98
IGL01874:Cyp8b1 APN 9 121915903 missense possibly damaging 0.71
IGL02004:Cyp8b1 APN 9 121914992 missense probably benign 0.01
IGL02218:Cyp8b1 APN 9 121915117 missense probably damaging 1.00
IGL02606:Cyp8b1 APN 9 121915735 missense probably damaging 1.00
IGL02724:Cyp8b1 APN 9 121915387 missense probably benign 0.12
IGL02796:Cyp8b1 UTSW 9 121915498 missense probably benign
R1052:Cyp8b1 UTSW 9 121915282 missense possibly damaging 0.67
R1572:Cyp8b1 UTSW 9 121914958 missense possibly damaging 0.94
R1639:Cyp8b1 UTSW 9 121914890 missense probably benign 0.01
R3833:Cyp8b1 UTSW 9 121916043 missense probably benign 0.00
R3938:Cyp8b1 UTSW 9 121915618 missense probably benign 0.05
R4151:Cyp8b1 UTSW 9 121916068 missense probably damaging 1.00
R4615:Cyp8b1 UTSW 9 121916098 nonsense probably null
R4625:Cyp8b1 UTSW 9 121915585 missense probably damaging 0.99
R5327:Cyp8b1 UTSW 9 121914884 missense probably damaging 0.99
R6391:Cyp8b1 UTSW 9 121915798 nonsense probably null
R6998:Cyp8b1 UTSW 9 121915993 missense probably benign
R7086:Cyp8b1 UTSW 9 121915289 missense probably benign 0.02
R7162:Cyp8b1 UTSW 9 121915711 missense probably damaging 0.99
R7210:Cyp8b1 UTSW 9 121915180 missense probably damaging 1.00
R7223:Cyp8b1 UTSW 9 121915097 missense probably damaging 1.00
R8352:Cyp8b1 UTSW 9 121915931 missense probably damaging 0.97
R8392:Cyp8b1 UTSW 9 121915234 missense probably damaging 0.98
R8452:Cyp8b1 UTSW 9 121915931 missense probably damaging 0.97
R8672:Cyp8b1 UTSW 9 121914920 missense probably benign 0.00
R8897:Cyp8b1 UTSW 9 121916292 start gained probably benign
R9484:Cyp8b1 UTSW 9 121915917 missense probably benign 0.00
R9764:Cyp8b1 UTSW 9 121915228 missense probably benign 0.03
RF013:Cyp8b1 UTSW 9 121915495 missense possibly damaging 0.59
Z1177:Cyp8b1 UTSW 9 121915531 missense probably benign 0.06
Z1177:Cyp8b1 UTSW 9 121916146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGGCGATAGAGGAAGCGTACC -3'
(R):5'- GCTGGAAGCCAAGAAGTCGTTCAC -3'

Sequencing Primer
(F):5'- AAGCGTACCTCATGGCTAGG -3'
(R):5'- GCCAAGAAGTCGTTCACTTTCAC -3'
Posted On 2014-01-29