Incidental Mutation 'R1223:Thoc5'
ID 152808
Institutional Source Beutler Lab
Gene Symbol Thoc5
Ensembl Gene ENSMUSG00000034274
Gene Name THO complex 5
Synonyms 1700060C24Rik, PK1.3, A430085L24Rik, Fmip
MMRRC Submission 039292-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1223 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 4895320-4928867 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4921922 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 449 (E449G)
Ref Sequence ENSEMBL: ENSMUSP00000099137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038237] [ENSMUST00000101615] [ENSMUST00000142543]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000038237
AA Change: E497G

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000045580
Gene: ENSMUSG00000034274
AA Change: E497G

DomainStartEndE-ValueType
Pfam:FimP 97 452 1.1e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101615
AA Change: E449G

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099137
Gene: ENSMUSG00000034274
AA Change: E449G

DomainStartEndE-ValueType
low complexity region 34 41 N/A INTRINSIC
Pfam:FimP 48 405 7.5e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121125
Predicted Effect probably benign
Transcript: ENSMUST00000142543
SMART Domains Protein: ENSMUSP00000118940
Gene: ENSMUSG00000034274

DomainStartEndE-ValueType
Pfam:FimP 1 301 1.3e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155872
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A T 16: 4,298,748 V873E probably damaging Het
Arl10 A G 13: 54,578,931 D174G probably damaging Het
Cd180 A T 13: 102,706,222 Y592F possibly damaging Het
Ces3a A T 8: 105,058,029 T548S probably benign Het
Chd2 T C 7: 73,484,517 E694G probably damaging Het
Commd3 T C 2: 18,674,968 Y163H probably benign Het
Cyp8b1 A G 9: 121,915,004 S421P possibly damaging Het
Cysltr2 A T 14: 73,030,099 V57E probably damaging Het
D430042O09Rik T A 7: 125,760,423 V62E possibly damaging Het
Ddx47 G A 6: 135,012,314 V34I possibly damaging Het
Dgkz T C 2: 91,939,315 probably benign Het
Dsg2 G T 18: 20,573,493 C22F probably benign Het
Gbp10 A C 5: 105,219,001 V455G probably damaging Het
Gm12185 T A 11: 48,907,276 I797F probably damaging Het
Lrrk2 A G 15: 91,673,635 E58G probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mybphl A G 3: 108,375,196 T182A possibly damaging Het
Olfr1154 G A 2: 87,902,819 P286S probably damaging Het
Olfr676 A T 7: 105,035,566 I123F probably benign Het
Osr1 C T 12: 9,579,699 L191F probably damaging Het
Pip4k2b G A 11: 97,718,894 R406C probably damaging Het
Plce1 C T 19: 38,702,013 L714F probably damaging Het
Plce1 T C 19: 38,767,226 F1886S probably damaging Het
Ppp1cc A G 5: 122,168,214 E32G probably damaging Het
Rnh1 A G 7: 141,163,207 L260P probably damaging Het
Serpinb3a T A 1: 107,047,552 N175I probably damaging Het
Sptbn5 T A 2: 120,072,044 I68F probably damaging Het
Tas1r2 A T 4: 139,660,204 T325S probably damaging Het
Tcirg1 T C 19: 3,898,733 N484S probably benign Het
Tenm3 A T 8: 48,240,396 M1833K possibly damaging Het
Usp34 A G 11: 23,446,464 probably null Het
Other mutations in Thoc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Thoc5 APN 11 4918147 missense probably damaging 0.96
IGL02039:Thoc5 APN 11 4922027 critical splice donor site probably null
IGL02227:Thoc5 APN 11 4926217 missense probably benign 0.02
IGL02970:Thoc5 APN 11 4904201 missense probably damaging 0.99
R0398:Thoc5 UTSW 11 4921978 missense possibly damaging 0.84
R0401:Thoc5 UTSW 11 4902213 utr 5 prime probably benign
R0453:Thoc5 UTSW 11 4918217 missense possibly damaging 0.60
R1438:Thoc5 UTSW 11 4911427 splice site probably benign
R1661:Thoc5 UTSW 11 4919792 missense probably benign 0.04
R1665:Thoc5 UTSW 11 4919792 missense probably benign 0.04
R1776:Thoc5 UTSW 11 4914517 splice site probably benign
R1830:Thoc5 UTSW 11 4914608 missense probably benign 0.02
R1912:Thoc5 UTSW 11 4915561 missense probably benign 0.15
R3001:Thoc5 UTSW 11 4928688 missense probably benign
R3002:Thoc5 UTSW 11 4928688 missense probably benign
R3783:Thoc5 UTSW 11 4920372 unclassified probably benign
R4534:Thoc5 UTSW 11 4924807 nonsense probably null
R4619:Thoc5 UTSW 11 4926218 missense probably damaging 0.96
R4747:Thoc5 UTSW 11 4904187 missense probably damaging 0.99
R5106:Thoc5 UTSW 11 4910630 missense probably damaging 1.00
R5310:Thoc5 UTSW 11 4910648 missense probably damaging 1.00
R5914:Thoc5 UTSW 11 4920416 missense possibly damaging 0.58
R5936:Thoc5 UTSW 11 4904133 missense probably damaging 1.00
R6167:Thoc5 UTSW 11 4915497 missense probably benign 0.12
R6209:Thoc5 UTSW 11 4905697 missense probably damaging 1.00
R6243:Thoc5 UTSW 11 4919753 missense possibly damaging 0.59
R6504:Thoc5 UTSW 11 4924815 nonsense probably null
R6833:Thoc5 UTSW 11 4919804 missense probably damaging 1.00
R6874:Thoc5 UTSW 11 4901261 missense probably damaging 1.00
R7048:Thoc5 UTSW 11 4926237 critical splice donor site probably null
R7197:Thoc5 UTSW 11 4915563 missense probably benign 0.01
R7753:Thoc5 UTSW 11 4902156 missense probably damaging 0.99
R7828:Thoc5 UTSW 11 4902306 start gained probably benign
R8416:Thoc5 UTSW 11 4926068 missense probably benign 0.41
R8428:Thoc5 UTSW 11 4926115 missense probably damaging 0.99
R8673:Thoc5 UTSW 11 4926061 missense possibly damaging 0.52
R8964:Thoc5 UTSW 11 4910647 missense possibly damaging 0.80
R9214:Thoc5 UTSW 11 4914303 missense probably benign 0.13
R9651:Thoc5 UTSW 11 4899883 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TGTCAGGTTGAGATGCCTCTGTCC -3'
(R):5'- AATGTCCTTAGTGAAGTGCAGCTCC -3'

Sequencing Primer
(F):5'- CCCTGGAGTGTGATGAGCAG -3'
(R):5'- TTAAAGCCTCTGCACGGATG -3'
Posted On 2014-01-29