Incidental Mutation 'R1223:Osr1'
ID 152811
Institutional Source Beutler Lab
Gene Symbol Osr1
Ensembl Gene ENSMUSG00000048387
Gene Name odd-skipped related transcription factor 1
Synonyms Odd1
MMRRC Submission 039292-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.746) question?
Stock # R1223 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 9570116-9581500 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 9579699 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 191 (L191F)
Ref Sequence ENSEMBL: ENSMUSP00000055486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057021] [ENSMUST00000217975]
AlphaFold Q9WVG7
Predicted Effect probably damaging
Transcript: ENSMUST00000057021
AA Change: L191F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055486
Gene: ENSMUSG00000048387
AA Change: L191F

DomainStartEndE-ValueType
low complexity region 134 151 N/A INTRINSIC
ZnF_C2H2 175 197 1.67e-2 SMART
ZnF_C2H2 203 225 2.4e-3 SMART
ZnF_C2H2 231 253 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217975
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation fail to form atrial septum and exhibit dilated atria with hypoplastic venous valves and blood backflow from the heart into systemic veins. Complete agenesis of adrenal glands, metanephric kidneys, gonads, and defects in pericardium formation are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A T 16: 4,298,748 V873E probably damaging Het
Arl10 A G 13: 54,578,931 D174G probably damaging Het
Cd180 A T 13: 102,706,222 Y592F possibly damaging Het
Ces3a A T 8: 105,058,029 T548S probably benign Het
Chd2 T C 7: 73,484,517 E694G probably damaging Het
Commd3 T C 2: 18,674,968 Y163H probably benign Het
Cyp8b1 A G 9: 121,915,004 S421P possibly damaging Het
Cysltr2 A T 14: 73,030,099 V57E probably damaging Het
D430042O09Rik T A 7: 125,760,423 V62E possibly damaging Het
Ddx47 G A 6: 135,012,314 V34I possibly damaging Het
Dgkz T C 2: 91,939,315 probably benign Het
Dsg2 G T 18: 20,573,493 C22F probably benign Het
Gbp10 A C 5: 105,219,001 V455G probably damaging Het
Gm12185 T A 11: 48,907,276 I797F probably damaging Het
Lrrk2 A G 15: 91,673,635 E58G probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mybphl A G 3: 108,375,196 T182A possibly damaging Het
Olfr1154 G A 2: 87,902,819 P286S probably damaging Het
Olfr676 A T 7: 105,035,566 I123F probably benign Het
Pip4k2b G A 11: 97,718,894 R406C probably damaging Het
Plce1 C T 19: 38,702,013 L714F probably damaging Het
Plce1 T C 19: 38,767,226 F1886S probably damaging Het
Ppp1cc A G 5: 122,168,214 E32G probably damaging Het
Rnh1 A G 7: 141,163,207 L260P probably damaging Het
Serpinb3a T A 1: 107,047,552 N175I probably damaging Het
Sptbn5 T A 2: 120,072,044 I68F probably damaging Het
Tas1r2 A T 4: 139,660,204 T325S probably damaging Het
Tcirg1 T C 19: 3,898,733 N484S probably benign Het
Tenm3 A T 8: 48,240,396 M1833K possibly damaging Het
Thoc5 A G 11: 4,921,922 E449G probably benign Het
Usp34 A G 11: 23,446,464 probably null Het
Other mutations in Osr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Osr1 APN 12 9579432 missense probably benign 0.00
IGL01508:Osr1 APN 12 9579370 missense probably damaging 1.00
IGL02583:Osr1 APN 12 9579675 missense probably damaging 1.00
R0077:Osr1 UTSW 12 9579691 missense probably damaging 1.00
R0218:Osr1 UTSW 12 9579639 missense probably benign 0.09
R1568:Osr1 UTSW 12 9579798 splice site probably null
R1924:Osr1 UTSW 12 9579268 missense probably damaging 1.00
R1939:Osr1 UTSW 12 9579687 missense probably damaging 1.00
R5580:Osr1 UTSW 12 9579325 missense probably damaging 0.99
R7713:Osr1 UTSW 12 9579253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGCCTCGCTTTGATTTCGCTAAC -3'
(R):5'- GGAATGCTTACAGCCACTGGAGAC -3'

Sequencing Primer
(F):5'- TTGGCTGCCACACAAGAG -3'
(R):5'- TACAGCCACTGGAGACTCTTG -3'
Posted On 2014-01-29