Incidental Mutation 'R1223:Arl10'
ID 152812
Institutional Source Beutler Lab
Gene Symbol Arl10
Ensembl Gene ENSMUSG00000025870
Gene Name ADP-ribosylation factor-like 10
Synonyms Arl10a, ARL10, Arm1
MMRRC Submission 039292-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1223 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 54575015-54581128 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54578931 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 174 (D174G)
Ref Sequence ENSEMBL: ENSMUSP00000026988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026988] [ENSMUST00000156024]
AlphaFold Q9QXJ4
Predicted Effect probably damaging
Transcript: ENSMUST00000026988
AA Change: D174G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026988
Gene: ENSMUSG00000025870
AA Change: D174G

transmembrane domain 10 32 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
Pfam:Arf 70 231 6.6e-38 PFAM
Pfam:SRPRB 74 203 9e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135354
Predicted Effect unknown
Transcript: ENSMUST00000142246
AA Change: D40G
SMART Domains Protein: ENSMUSP00000114680
Gene: ENSMUSG00000025870
AA Change: D40G

Pfam:Arf 1 54 4.3e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156024
AA Change: D174G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116506
Gene: ENSMUSG00000025870
AA Change: D174G

transmembrane domain 10 32 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
Pfam:Arf 70 191 7.7e-32 PFAM
Pfam:SRPRB 74 194 6e-7 PFAM
Pfam:Miro 78 186 3e-11 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A T 16: 4,298,748 V873E probably damaging Het
Cd180 A T 13: 102,706,222 Y592F possibly damaging Het
Ces3a A T 8: 105,058,029 T548S probably benign Het
Chd2 T C 7: 73,484,517 E694G probably damaging Het
Commd3 T C 2: 18,674,968 Y163H probably benign Het
Cyp8b1 A G 9: 121,915,004 S421P possibly damaging Het
Cysltr2 A T 14: 73,030,099 V57E probably damaging Het
D430042O09Rik T A 7: 125,760,423 V62E possibly damaging Het
Ddx47 G A 6: 135,012,314 V34I possibly damaging Het
Dgkz T C 2: 91,939,315 probably benign Het
Dsg2 G T 18: 20,573,493 C22F probably benign Het
Gbp10 A C 5: 105,219,001 V455G probably damaging Het
Gm12185 T A 11: 48,907,276 I797F probably damaging Het
Lrrk2 A G 15: 91,673,635 E58G probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mybphl A G 3: 108,375,196 T182A possibly damaging Het
Olfr1154 G A 2: 87,902,819 P286S probably damaging Het
Olfr676 A T 7: 105,035,566 I123F probably benign Het
Osr1 C T 12: 9,579,699 L191F probably damaging Het
Pip4k2b G A 11: 97,718,894 R406C probably damaging Het
Plce1 C T 19: 38,702,013 L714F probably damaging Het
Plce1 T C 19: 38,767,226 F1886S probably damaging Het
Ppp1cc A G 5: 122,168,214 E32G probably damaging Het
Rnh1 A G 7: 141,163,207 L260P probably damaging Het
Serpinb3a T A 1: 107,047,552 N175I probably damaging Het
Sptbn5 T A 2: 120,072,044 I68F probably damaging Het
Tas1r2 A T 4: 139,660,204 T325S probably damaging Het
Tcirg1 T C 19: 3,898,733 N484S probably benign Het
Tenm3 A T 8: 48,240,396 M1833K possibly damaging Het
Thoc5 A G 11: 4,921,922 E449G probably benign Het
Usp34 A G 11: 23,446,464 probably null Het
Other mutations in Arl10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02150:Arl10 APN 13 54578849 missense probably damaging 1.00
IGL02801:Arl10 APN 13 54575883 missense probably benign 0.17
IGL03114:Arl10 APN 13 54575766 unclassified probably benign
R0015:Arl10 UTSW 13 54575957 splice site probably benign
R0976:Arl10 UTSW 13 54575808 unclassified probably benign
R2125:Arl10 UTSW 13 54579124 splice site probably null
R2239:Arl10 UTSW 13 54575149 missense probably benign 0.23
R2380:Arl10 UTSW 13 54575149 missense probably benign 0.23
R5828:Arl10 UTSW 13 54578955 missense probably damaging 1.00
R6222:Arl10 UTSW 13 54578831 missense probably damaging 0.99
R6602:Arl10 UTSW 13 54578937 missense probably damaging 1.00
R9186:Arl10 UTSW 13 54578807 missense probably damaging 1.00
Z1176:Arl10 UTSW 13 54580724 missense probably benign 0.10
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acacacctacaatcccagaac -3'
Posted On 2014-01-29