Incidental Mutation 'R1223:Adcy9'
ID 152816
Institutional Source Beutler Lab
Gene Symbol Adcy9
Ensembl Gene ENSMUSG00000005580
Gene Name adenylate cyclase 9
Synonyms D16Wsu65e, ACtp10
MMRRC Submission 039292-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.600) question?
Stock # R1223 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 4287529-4420498 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 4298748 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 873 (V873E)
Ref Sequence ENSEMBL: ENSMUSP00000113498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005719] [ENSMUST00000117801] [ENSMUST00000120080]
AlphaFold P51830
Predicted Effect probably damaging
Transcript: ENSMUST00000005719
AA Change: V873E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005719
Gene: ENSMUSG00000005580
AA Change: V873E

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 49 75 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 177 196 N/A INTRINSIC
transmembrane domain 216 235 N/A INTRINSIC
transmembrane domain 242 261 N/A INTRINSIC
transmembrane domain 281 300 N/A INTRINSIC
CYCc 325 547 1.69e-63 SMART
transmembrane domain 791 813 N/A INTRINSIC
transmembrane domain 823 845 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
transmembrane domain 977 996 N/A INTRINSIC
CYCc 1023 1227 1.26e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117801
AA Change: V873E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113498
Gene: ENSMUSG00000005580
AA Change: V873E

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 49 75 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 177 196 N/A INTRINSIC
transmembrane domain 216 235 N/A INTRINSIC
transmembrane domain 242 261 N/A INTRINSIC
transmembrane domain 281 300 N/A INTRINSIC
CYCc 325 547 1.69e-63 SMART
transmembrane domain 791 813 N/A INTRINSIC
transmembrane domain 823 845 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
transmembrane domain 977 996 N/A INTRINSIC
CYCc 1023 1227 1.26e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120080
AA Change: V636E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113421
Gene: ENSMUSG00000005580
AA Change: V636E

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 44 63 N/A INTRINSIC
CYCc 88 310 1.69e-63 SMART
transmembrane domain 554 576 N/A INTRINSIC
transmembrane domain 586 608 N/A INTRINSIC
transmembrane domain 621 643 N/A INTRINSIC
transmembrane domain 653 675 N/A INTRINSIC
transmembrane domain 740 759 N/A INTRINSIC
CYCc 786 990 1.26e-39 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. It is regulated by a family of G protein-coupled receptors, protein kinases, and calcium. The type 9 adenylyl cyclase is a widely distributed adenylyl cyclase, and it is stimulated by beta-adrenergic receptor activation but is insensitive to forskolin, calcium, and somatostatin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show an increased IgG1 response to ovalbumin challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl10 A G 13: 54,578,931 D174G probably damaging Het
Cd180 A T 13: 102,706,222 Y592F possibly damaging Het
Ces3a A T 8: 105,058,029 T548S probably benign Het
Chd2 T C 7: 73,484,517 E694G probably damaging Het
Commd3 T C 2: 18,674,968 Y163H probably benign Het
Cyp8b1 A G 9: 121,915,004 S421P possibly damaging Het
Cysltr2 A T 14: 73,030,099 V57E probably damaging Het
D430042O09Rik T A 7: 125,760,423 V62E possibly damaging Het
Ddx47 G A 6: 135,012,314 V34I possibly damaging Het
Dgkz T C 2: 91,939,315 probably benign Het
Dsg2 G T 18: 20,573,493 C22F probably benign Het
Gbp10 A C 5: 105,219,001 V455G probably damaging Het
Gm12185 T A 11: 48,907,276 I797F probably damaging Het
Lrrk2 A G 15: 91,673,635 E58G probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mybphl A G 3: 108,375,196 T182A possibly damaging Het
Olfr1154 G A 2: 87,902,819 P286S probably damaging Het
Olfr676 A T 7: 105,035,566 I123F probably benign Het
Osr1 C T 12: 9,579,699 L191F probably damaging Het
Pip4k2b G A 11: 97,718,894 R406C probably damaging Het
Plce1 C T 19: 38,702,013 L714F probably damaging Het
Plce1 T C 19: 38,767,226 F1886S probably damaging Het
Ppp1cc A G 5: 122,168,214 E32G probably damaging Het
Rnh1 A G 7: 141,163,207 L260P probably damaging Het
Serpinb3a T A 1: 107,047,552 N175I probably damaging Het
Sptbn5 T A 2: 120,072,044 I68F probably damaging Het
Tas1r2 A T 4: 139,660,204 T325S probably damaging Het
Tcirg1 T C 19: 3,898,733 N484S probably benign Het
Tenm3 A T 8: 48,240,396 M1833K possibly damaging Het
Thoc5 A G 11: 4,921,922 E449G probably benign Het
Usp34 A G 11: 23,446,464 probably null Het
Other mutations in Adcy9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Adcy9 APN 16 4304582 missense probably benign
IGL00326:Adcy9 APN 16 4294696 missense probably benign
IGL00792:Adcy9 APN 16 4288539 missense probably damaging 1.00
IGL01610:Adcy9 APN 16 4418114 missense probably damaging 1.00
IGL02376:Adcy9 APN 16 4418680 missense probably benign 0.01
IGL02424:Adcy9 APN 16 4288597 missense probably damaging 1.00
IGL03097:Adcy9 UTSW 16 4418066 missense possibly damaging 0.94
PIT4243001:Adcy9 UTSW 16 4418407 missense probably damaging 1.00
R0043:Adcy9 UTSW 16 4289015 missense probably benign 0.12
R0085:Adcy9 UTSW 16 4288224 missense probably benign
R0105:Adcy9 UTSW 16 4288388 missense probably damaging 1.00
R0105:Adcy9 UTSW 16 4288388 missense probably damaging 1.00
R0371:Adcy9 UTSW 16 4288047 missense probably benign 0.06
R0613:Adcy9 UTSW 16 4419539 missense probably damaging 1.00
R0689:Adcy9 UTSW 16 4312804 splice site probably benign
R0744:Adcy9 UTSW 16 4419271 missense possibly damaging 0.69
R0836:Adcy9 UTSW 16 4419271 missense possibly damaging 0.69
R1251:Adcy9 UTSW 16 4311531 missense probably damaging 0.99
R1689:Adcy9 UTSW 16 4297562 splice site probably null
R1922:Adcy9 UTSW 16 4311657 missense probably damaging 1.00
R1955:Adcy9 UTSW 16 4418659 missense possibly damaging 0.63
R1989:Adcy9 UTSW 16 4298727 missense probably damaging 1.00
R1998:Adcy9 UTSW 16 4297412 missense probably benign 0.00
R2321:Adcy9 UTSW 16 4288268 missense probably damaging 1.00
R3160:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R3161:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R3162:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R3162:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R4065:Adcy9 UTSW 16 4288434 missense probably damaging 1.00
R4909:Adcy9 UTSW 16 4298754 missense probably benign 0.03
R5078:Adcy9 UTSW 16 4323907 missense probably benign 0.00
R5870:Adcy9 UTSW 16 4418368 missense probably damaging 1.00
R5968:Adcy9 UTSW 16 4298742 missense probably damaging 1.00
R5975:Adcy9 UTSW 16 4311567 missense probably damaging 0.98
R6014:Adcy9 UTSW 16 4418819 missense probably damaging 1.00
R6035:Adcy9 UTSW 16 4304513 missense probably benign
R6035:Adcy9 UTSW 16 4304513 missense probably benign
R6081:Adcy9 UTSW 16 4294681 missense probably benign
R6192:Adcy9 UTSW 16 4287954 missense probably benign
R6604:Adcy9 UTSW 16 4304407 missense probably damaging 0.98
R6739:Adcy9 UTSW 16 4418794 missense probably benign
R6829:Adcy9 UTSW 16 4307154 critical splice donor site probably null
R6986:Adcy9 UTSW 16 4311577 missense probably damaging 0.99
R7491:Adcy9 UTSW 16 4418809 missense possibly damaging 0.51
R7561:Adcy9 UTSW 16 4418164 missense probably damaging 1.00
R7614:Adcy9 UTSW 16 4418224 missense probably damaging 1.00
R7803:Adcy9 UTSW 16 4304380 missense probably benign 0.11
R7993:Adcy9 UTSW 16 4418002 missense probably damaging 1.00
R8444:Adcy9 UTSW 16 4288623 missense probably damaging 1.00
R8519:Adcy9 UTSW 16 4288128 missense possibly damaging 0.57
R8546:Adcy9 UTSW 16 4418905 missense probably benign 0.02
R8751:Adcy9 UTSW 16 4311628 missense probably damaging 0.97
R9004:Adcy9 UTSW 16 4288514 missense probably damaging 1.00
R9076:Adcy9 UTSW 16 4288823 missense probably damaging 1.00
R9351:Adcy9 UTSW 16 4418364 missense probably damaging 1.00
R9491:Adcy9 UTSW 16 4418188 missense probably damaging 1.00
R9571:Adcy9 UTSW 16 4323789 missense probably benign 0.14
R9614:Adcy9 UTSW 16 4288683 missense probably damaging 1.00
X0023:Adcy9 UTSW 16 4323916 missense probably benign 0.00
Z1176:Adcy9 UTSW 16 4307232 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTAGCACCTGTTATGTGCCACC -3'
(R):5'- AAGCCCCACTGAGGACTTCTTGAC -3'

Sequencing Primer
(F):5'- atgtgtgtgtgccattatgtg -3'
(R):5'- CCACTGAGGACTTCTTGACTTATGG -3'
Posted On 2014-01-29