Mutagenetix > Incidental Mutation

Incidental Mutation 'R1223:Tcirg1'

152818

Institutional Source

Beutler Lab

Gene Symbol

Tcirg1

Ensembl Gene

ENSMUSG00000001750

Gene Name

T cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3

Synonyms

Atp6i, V-ATPase a3, ATP6a3, TIRC7, OC-116

MMRRC Submission

039292-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.807) question?

Stock #

R1223 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3896050-3907133 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 3898733 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 484 (N484S)

Ref Sequence

ENSEMBL: ENSMUSP00000122474 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001801] [ENSMUST00000025760] [ENSMUST00000072055] [ENSMUST00000122885] [ENSMUST00000126070] [ENSMUST00000128694] [ENSMUST00000145791] [ENSMUST00000135070]

AlphaFold

Q9JHF5

Predicted Effect

probably benign
Transcript: ENSMUST00000001801
AA Change: N484S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000001801
Gene: ENSMUSG00000001750
AA Change: N484S

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	26	830	4.4e-287	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000025760

SMART Domains

Protein: ENSMUSP00000025760
Gene: ENSMUSG00000024843

Domain	Start	End	E-Value	Type
low complexity region	13	24	N/A	INTRINSIC
low complexity region	53	74	N/A	INTRINSIC
Pfam:APH	108	373	2.4e-11	PFAM
Pfam:Choline_kinase	135	370	8.2e-82	PFAM
Pfam:EcKinase	211	345	2.5e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000072055

SMART Domains

Protein: ENSMUSP00000071933
Gene: ENSMUSG00000024843

Domain	Start	End	E-Value	Type
low complexity region	13	24	N/A	INTRINSIC
low complexity region	53	74	N/A	INTRINSIC
Pfam:APH	108	358	6.4e-12	PFAM
Pfam:Choline_kinase	135	352	1.6e-84	PFAM
Pfam:EcKinase	190	329	2e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000122885

SMART Domains

Protein: ENSMUSP00000114768
Gene: ENSMUSG00000001750

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	1	91	2.9e-44	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125792

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125859

Predicted Effect

probably benign
Transcript: ENSMUST00000126070
AA Change: N484S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000120531
Gene: ENSMUSG00000001750
AA Change: N484S

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	829	1.2e-277	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126643

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127308

Predicted Effect

probably benign
Transcript: ENSMUST00000128694

SMART Domains

Protein: ENSMUSP00000119919
Gene: ENSMUSG00000024843

Domain	Start	End	E-Value	Type
PDB:4DA5\|B	1	150	2e-60	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131327

Predicted Effect

probably benign
Transcript: ENSMUST00000132164

SMART Domains

Protein: ENSMUSP00000120968
Gene: ENSMUSG00000001750

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	1	190	4.5e-48	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000145791
AA Change: N484S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000122474
Gene: ENSMUSG00000001750
AA Change: N484S

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	26	830	4.4e-287	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162688

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134698

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159824

Predicted Effect

probably benign
Transcript: ENSMUST00000135070

SMART Domains

Protein: ENSMUSP00000121241
Gene: ENSMUSG00000001750

Domain	Start	End	E-Value	Type
low complexity region	59	70	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 89.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Through alternate splicing, this gene encodes two proteins with similarity to subunits of the vacuolar ATPase (V-ATPase) but the encoded proteins seem to have different functions. V-ATPase is a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, and receptor-mediated endocytosis. V-ATPase is comprised of a cytosolic V1 domain and a transmembrane V0 domain. Mutations in this gene are associated with infantile malignant osteopetrosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for mutant alleles exhibit severe osteopetrosis with increased bone density due to failure of secondary bone resorption. Mutants lack teeth and die around 30-40 days of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy9	A	T	16: 4,298,748	V873E	probably damaging	Het
Arl10	A	G	13: 54,578,931	D174G	probably damaging	Het
Cd180	A	T	13: 102,706,222	Y592F	possibly damaging	Het
Ces3a	A	T	8: 105,058,029	T548S	probably benign	Het
Chd2	T	C	7: 73,484,517	E694G	probably damaging	Het
Commd3	T	C	2: 18,674,968	Y163H	probably benign	Het
Cyp8b1	A	G	9: 121,915,004	S421P	possibly damaging	Het
Cysltr2	A	T	14: 73,030,099	V57E	probably damaging	Het
D430042O09Rik	T	A	7: 125,760,423	V62E	possibly damaging	Het
Ddx47	G	A	6: 135,012,314	V34I	possibly damaging	Het
Dgkz	T	C	2: 91,939,315		probably benign	Het
Dsg2	G	T	18: 20,573,493	C22F	probably benign	Het
Gbp10	A	C	5: 105,219,001	V455G	probably damaging	Het
Gm12185	T	A	11: 48,907,276	I797F	probably damaging	Het
Lrrk2	A	G	15: 91,673,635	E58G	probably benign	Het
Mrgprb1	A	G	7: 48,447,687	V159A	possibly damaging	Het
Mybphl	A	G	3: 108,375,196	T182A	possibly damaging	Het
Olfr1154	G	A	2: 87,902,819	P286S	probably damaging	Het
Olfr676	A	T	7: 105,035,566	I123F	probably benign	Het
Osr1	C	T	12: 9,579,699	L191F	probably damaging	Het
Pip4k2b	G	A	11: 97,718,894	R406C	probably damaging	Het
Plce1	C	T	19: 38,702,013	L714F	probably damaging	Het
Plce1	T	C	19: 38,767,226	F1886S	probably damaging	Het
Ppp1cc	A	G	5: 122,168,214	E32G	probably damaging	Het
Rnh1	A	G	7: 141,163,207	L260P	probably damaging	Het
Serpinb3a	T	A	1: 107,047,552	N175I	probably damaging	Het
Sptbn5	T	A	2: 120,072,044	I68F	probably damaging	Het
Tas1r2	A	T	4: 139,660,204	T325S	probably damaging	Het
Tenm3	A	T	8: 48,240,396	M1833K	possibly damaging	Het
Thoc5	A	G	11: 4,921,922	E449G	probably benign	Het
Usp34	A	G	11: 23,446,464		probably null	Het

Other mutations in Tcirg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00488:Tcirg1	APN	19	3899108	missense	possibly damaging	0.94
IGL01735:Tcirg1	APN	19	3904210	splice site	probably benign
IGL03143:Tcirg1	APN	19	3898811	missense	probably damaging	1.00
R0732:Tcirg1	UTSW	19	3897866	missense	possibly damaging	0.56
R1131:Tcirg1	UTSW	19	3896301	missense	probably damaging	1.00
R1548:Tcirg1	UTSW	19	3896845	missense	probably benign	0.03
R1867:Tcirg1	UTSW	19	3898835	missense	probably damaging	1.00
R1926:Tcirg1	UTSW	19	3902843	intron	probably benign
R2262:Tcirg1	UTSW	19	3903591	missense	possibly damaging	0.89
R4367:Tcirg1	UTSW	19	3899069	missense	probably damaging	1.00
R5327:Tcirg1	UTSW	19	3902342	critical splice donor site	probably null
R5417:Tcirg1	UTSW	19	3903509	splice site	probably null
R5551:Tcirg1	UTSW	19	3898858	missense	probably damaging	1.00
R5930:Tcirg1	UTSW	19	3902424	missense	possibly damaging	0.95
R6026:Tcirg1	UTSW	19	3897487	missense	probably benign
R6517:Tcirg1	UTSW	19	3901933	missense	probably damaging	1.00
R7039:Tcirg1	UTSW	19	3896666	missense	probably damaging	1.00
R7181:Tcirg1	UTSW	19	3903576	missense	probably null	0.56
R7422:Tcirg1	UTSW	19	3899008	missense	possibly damaging	0.61
R7631:Tcirg1	UTSW	19	3897160	missense	probably damaging	1.00
R7768:Tcirg1	UTSW	19	3902900	missense	possibly damaging	0.91
R7899:Tcirg1	UTSW	19	3899104	missense	probably damaging	1.00
R8110:Tcirg1	UTSW	19	3899099	missense	probably damaging	1.00
R8535:Tcirg1	UTSW	19	3896324	missense	probably damaging	1.00
R9233:Tcirg1	UTSW	19	3902543	missense	probably damaging	1.00
R9292:Tcirg1	UTSW	19	3897840	missense	probably damaging	1.00
R9611:Tcirg1	UTSW	19	3903400	missense	probably benign	0.09
R9695:Tcirg1	UTSW	19	3902360	missense	probably null	0.69
Z1176:Tcirg1	UTSW	19	3903425	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATGCACCAGTATGCCCACTTACCG -3'
(R):5'- AACAGCCTCTTGAGCTGAGCTAAAC -3'

Sequencing Primer
(F):5'- TTACCGGGTCAATGCCAAAG -3'
(R):5'- TTGAGCTGAGCTAAACAGCAC -3'

Posted On

2014-01-29