Incidental Mutation 'R1223:Plce1'
ID 152819
Institutional Source Beutler Lab
Gene Symbol Plce1
Ensembl Gene ENSMUSG00000024998
Gene Name phospholipase C, epsilon 1
Synonyms PLCepsilon, 4933403A21Rik
MMRRC Submission 039292-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.488) question?
Stock # R1223 (G1)
Quality Score 203
Status Not validated
Chromosome 19
Chromosomal Location 38469557-38773474 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 38690457 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 714 (L714F)
Ref Sequence ENSEMBL: ENSMUSP00000138360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169713] [ENSMUST00000182267] [ENSMUST00000182481]
AlphaFold Q8K4S1
Predicted Effect probably damaging
Transcript: ENSMUST00000169713
AA Change: L714F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130604
Gene: ENSMUSG00000024998
AA Change: L714F

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 7.6e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182267
AA Change: L714F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138330
Gene: ENSMUSG00000024998
AA Change: L714F

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 5.9e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1552 1581 N/A INTRINSIC
SCOP:d1qasa3 1648 1676 1e-3 SMART
low complexity region 1680 1694 N/A INTRINSIC
PLCYc 1724 1840 4.28e-46 SMART
C2 1864 1962 3.7e-10 SMART
PDB:2BYE|A 2000 2108 6e-47 PDB
RA 2129 2232 1.12e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182481
AA Change: L714F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138360
Gene: ENSMUSG00000024998
AA Change: L714F

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 8e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase enzyme that catalyzes the hydrolysis of phosphatidylinositol-4,5-bisphosphate to generate two second messengers: inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DAG). These second messengers subsequently regulate various processes affecting cell growth, differentiation, and gene expression. This enzyme is regulated by small monomeric GTPases of the Ras and Rho families and by heterotrimeric G proteins. In addition to its phospholipase C catalytic activity, this enzyme has an N-terminal domain with guanine nucleotide exchange (GEF) activity. Mutations in this gene cause early-onset nephrotic syndrome; characterized by proteinuria, edema, and diffuse mesangial sclerosis or focal and segmental glomerulosclerosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in a congenital semilunar valvulogenesis defect which causes regurgitation and stenosis, and decreased incidence of induced skin tumors. Another mutant exhibits decreased cardiac contraction and increased hypertrophy in response to chronic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A T 16: 4,116,612 (GRCm39) V873E probably damaging Het
Arl10 A G 13: 54,726,744 (GRCm39) D174G probably damaging Het
Cd180 A T 13: 102,842,730 (GRCm39) Y592F possibly damaging Het
Ces3a A T 8: 105,784,661 (GRCm39) T548S probably benign Het
Chd2 T C 7: 73,134,265 (GRCm39) E694G probably damaging Het
Commd3 T C 2: 18,679,779 (GRCm39) Y163H probably benign Het
Cyp8b1 A G 9: 121,744,070 (GRCm39) S421P possibly damaging Het
Cysltr2 A T 14: 73,267,539 (GRCm39) V57E probably damaging Het
Ddx47 G A 6: 134,989,277 (GRCm39) V34I possibly damaging Het
Dgkz T C 2: 91,769,660 (GRCm39) probably benign Het
Dsg2 G T 18: 20,706,550 (GRCm39) C22F probably benign Het
Gbp10 A C 5: 105,366,867 (GRCm39) V455G probably damaging Het
Gm12185 T A 11: 48,798,103 (GRCm39) I797F probably damaging Het
Katnip T A 7: 125,359,595 (GRCm39) V62E possibly damaging Het
Lrrk2 A G 15: 91,557,838 (GRCm39) E58G probably benign Het
Mrgprb1 A G 7: 48,097,435 (GRCm39) V159A possibly damaging Het
Mybphl A G 3: 108,282,512 (GRCm39) T182A possibly damaging Het
Or52e7 A T 7: 104,684,773 (GRCm39) I123F probably benign Het
Or9m1 G A 2: 87,733,163 (GRCm39) P286S probably damaging Het
Osr1 C T 12: 9,629,699 (GRCm39) L191F probably damaging Het
Pip4k2b G A 11: 97,609,720 (GRCm39) R406C probably damaging Het
Ppp1cc A G 5: 122,306,277 (GRCm39) E32G probably damaging Het
Rnh1 A G 7: 140,743,120 (GRCm39) L260P probably damaging Het
Serpinb3a T A 1: 106,975,282 (GRCm39) N175I probably damaging Het
Sptbn5 T A 2: 119,902,525 (GRCm39) I68F probably damaging Het
Tas1r2 A T 4: 139,387,515 (GRCm39) T325S probably damaging Het
Tcirg1 T C 19: 3,948,733 (GRCm39) N484S probably benign Het
Tenm3 A T 8: 48,693,431 (GRCm39) M1833K possibly damaging Het
Thoc5 A G 11: 4,871,922 (GRCm39) E449G probably benign Het
Usp34 A G 11: 23,396,464 (GRCm39) probably null Het
Other mutations in Plce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Plce1 APN 19 38,734,232 (GRCm39) missense probably damaging 0.99
IGL00336:Plce1 APN 19 38,640,350 (GRCm39) missense probably damaging 1.00
IGL00430:Plce1 APN 19 38,713,461 (GRCm39) missense probably damaging 1.00
IGL00466:Plce1 APN 19 38,709,473 (GRCm39) missense probably damaging 0.99
IGL00477:Plce1 APN 19 38,513,576 (GRCm39) missense probably benign 0.39
IGL00839:Plce1 APN 19 38,687,006 (GRCm39) missense probably damaging 1.00
IGL01292:Plce1 APN 19 38,640,229 (GRCm39) splice site probably benign
IGL01665:Plce1 APN 19 38,513,331 (GRCm39) missense probably benign 0.01
IGL01826:Plce1 APN 19 38,727,682 (GRCm39) splice site probably benign
IGL01833:Plce1 APN 19 38,709,425 (GRCm39) missense probably damaging 1.00
IGL02201:Plce1 APN 19 38,757,890 (GRCm39) splice site probably benign
IGL02276:Plce1 APN 19 38,513,201 (GRCm39) missense probably benign 0.05
IGL02477:Plce1 APN 19 38,707,997 (GRCm39) splice site probably benign
IGL02746:Plce1 APN 19 38,686,916 (GRCm39) missense probably damaging 1.00
Angel_food UTSW 19 38,715,457 (GRCm39) splice site probably benign
Heavenly UTSW 19 38,766,433 (GRCm39) missense probably damaging 1.00
R0058:Plce1 UTSW 19 38,513,628 (GRCm39) missense possibly damaging 0.90
R0058:Plce1 UTSW 19 38,513,628 (GRCm39) missense possibly damaging 0.90
R0064:Plce1 UTSW 19 38,769,228 (GRCm39) critical splice donor site probably null
R0116:Plce1 UTSW 19 38,710,265 (GRCm39) missense probably benign
R0138:Plce1 UTSW 19 38,512,863 (GRCm39) missense possibly damaging 0.49
R0240:Plce1 UTSW 19 38,717,330 (GRCm39) missense probably damaging 0.99
R0240:Plce1 UTSW 19 38,717,330 (GRCm39) missense probably damaging 0.99
R0504:Plce1 UTSW 19 38,766,465 (GRCm39) splice site probably benign
R0506:Plce1 UTSW 19 38,748,582 (GRCm39) missense probably benign 0.04
R0578:Plce1 UTSW 19 38,766,383 (GRCm39) missense probably damaging 1.00
R0645:Plce1 UTSW 19 38,766,433 (GRCm39) missense probably damaging 1.00
R0730:Plce1 UTSW 19 38,705,135 (GRCm39) missense probably damaging 0.98
R0920:Plce1 UTSW 19 38,724,965 (GRCm39) missense probably damaging 1.00
R1223:Plce1 UTSW 19 38,755,670 (GRCm39) missense probably damaging 1.00
R1484:Plce1 UTSW 19 38,693,783 (GRCm39) nonsense probably null
R1488:Plce1 UTSW 19 38,705,247 (GRCm39) missense possibly damaging 0.92
R1598:Plce1 UTSW 19 38,709,440 (GRCm39) missense probably damaging 1.00
R1624:Plce1 UTSW 19 38,713,219 (GRCm39) missense probably damaging 1.00
R1732:Plce1 UTSW 19 38,705,282 (GRCm39) missense possibly damaging 0.56
R1778:Plce1 UTSW 19 38,769,234 (GRCm39) splice site probably benign
R1797:Plce1 UTSW 19 38,747,392 (GRCm39) critical splice donor site probably null
R1872:Plce1 UTSW 19 38,748,521 (GRCm39) missense probably damaging 1.00
R1876:Plce1 UTSW 19 38,769,067 (GRCm39) missense probably damaging 1.00
R1991:Plce1 UTSW 19 38,766,368 (GRCm39) missense probably damaging 1.00
R2080:Plce1 UTSW 19 38,715,457 (GRCm39) splice site probably benign
R2103:Plce1 UTSW 19 38,766,368 (GRCm39) missense probably damaging 1.00
R2376:Plce1 UTSW 19 38,766,430 (GRCm39) missense probably benign 0.02
R2471:Plce1 UTSW 19 38,768,370 (GRCm39) missense probably damaging 1.00
R2511:Plce1 UTSW 19 38,748,498 (GRCm39) missense probably damaging 1.00
R2842:Plce1 UTSW 19 38,512,727 (GRCm39) missense probably damaging 1.00
R3037:Plce1 UTSW 19 38,766,328 (GRCm39) missense probably damaging 0.98
R3104:Plce1 UTSW 19 38,608,963 (GRCm39) missense probably benign 0.00
R3700:Plce1 UTSW 19 38,693,781 (GRCm39) missense probably damaging 1.00
R3750:Plce1 UTSW 19 38,766,343 (GRCm39) missense probably benign
R3753:Plce1 UTSW 19 38,640,278 (GRCm39) missense probably benign 0.09
R4027:Plce1 UTSW 19 38,512,709 (GRCm39) missense probably damaging 1.00
R4057:Plce1 UTSW 19 38,748,563 (GRCm39) missense probably damaging 1.00
R4376:Plce1 UTSW 19 38,693,891 (GRCm39) critical splice donor site probably null
R4433:Plce1 UTSW 19 38,755,745 (GRCm39) missense probably damaging 1.00
R4520:Plce1 UTSW 19 38,512,763 (GRCm39) missense possibly damaging 0.46
R4521:Plce1 UTSW 19 38,512,763 (GRCm39) missense possibly damaging 0.46
R4522:Plce1 UTSW 19 38,512,763 (GRCm39) missense possibly damaging 0.46
R4524:Plce1 UTSW 19 38,512,763 (GRCm39) missense possibly damaging 0.46
R4650:Plce1 UTSW 19 38,513,088 (GRCm39) missense probably benign 0.30
R4673:Plce1 UTSW 19 38,737,840 (GRCm39) missense possibly damaging 0.51
R4701:Plce1 UTSW 19 38,713,451 (GRCm39) missense probably benign 0.33
R4828:Plce1 UTSW 19 38,757,943 (GRCm39) missense probably damaging 1.00
R5103:Plce1 UTSW 19 38,755,659 (GRCm39) missense probably damaging 1.00
R5112:Plce1 UTSW 19 38,640,277 (GRCm39) missense probably benign 0.00
R5236:Plce1 UTSW 19 38,758,791 (GRCm39) missense probably benign 0.11
R5268:Plce1 UTSW 19 38,747,279 (GRCm39) missense possibly damaging 0.71
R5288:Plce1 UTSW 19 38,748,535 (GRCm39) missense probably damaging 1.00
R5384:Plce1 UTSW 19 38,748,535 (GRCm39) missense probably damaging 1.00
R5386:Plce1 UTSW 19 38,748,535 (GRCm39) missense probably damaging 1.00
R5448:Plce1 UTSW 19 38,768,361 (GRCm39) missense probably damaging 1.00
R5452:Plce1 UTSW 19 38,608,926 (GRCm39) missense probably benign 0.01
R6004:Plce1 UTSW 19 38,710,315 (GRCm39) missense probably damaging 1.00
R6062:Plce1 UTSW 19 38,513,195 (GRCm39) missense probably benign
R6147:Plce1 UTSW 19 38,690,481 (GRCm39) missense probably damaging 1.00
R6247:Plce1 UTSW 19 38,734,289 (GRCm39) missense probably damaging 1.00
R6278:Plce1 UTSW 19 38,713,495 (GRCm39) splice site probably null
R6306:Plce1 UTSW 19 38,757,909 (GRCm39) missense probably damaging 1.00
R6317:Plce1 UTSW 19 38,512,974 (GRCm39) nonsense probably null
R6437:Plce1 UTSW 19 38,513,576 (GRCm39) missense probably benign 0.39
R6522:Plce1 UTSW 19 38,736,965 (GRCm39) splice site probably null
R7034:Plce1 UTSW 19 38,727,801 (GRCm39) missense probably damaging 1.00
R7036:Plce1 UTSW 19 38,727,801 (GRCm39) missense probably damaging 1.00
R7037:Plce1 UTSW 19 38,690,461 (GRCm39) missense probably damaging 1.00
R7069:Plce1 UTSW 19 38,747,384 (GRCm39) missense probably damaging 1.00
R7180:Plce1 UTSW 19 38,768,229 (GRCm39) missense probably damaging 1.00
R7189:Plce1 UTSW 19 38,748,581 (GRCm39) missense probably damaging 0.97
R7227:Plce1 UTSW 19 38,715,346 (GRCm39) missense probably benign 0.00
R7253:Plce1 UTSW 19 38,686,952 (GRCm39) missense probably damaging 1.00
R7278:Plce1 UTSW 19 38,768,340 (GRCm39) missense possibly damaging 0.58
R7287:Plce1 UTSW 19 38,690,347 (GRCm39) missense probably benign 0.02
R7422:Plce1 UTSW 19 38,640,329 (GRCm39) missense probably damaging 1.00
R7557:Plce1 UTSW 19 38,753,848 (GRCm39) missense probably benign 0.30
R7607:Plce1 UTSW 19 38,513,196 (GRCm39) missense probably benign
R7615:Plce1 UTSW 19 38,513,109 (GRCm39) missense probably benign 0.18
R7653:Plce1 UTSW 19 38,737,763 (GRCm39) missense probably benign 0.20
R7685:Plce1 UTSW 19 38,736,877 (GRCm39) missense probably benign 0.00
R7716:Plce1 UTSW 19 38,705,295 (GRCm39) missense probably benign
R7744:Plce1 UTSW 19 38,608,899 (GRCm39) missense possibly damaging 0.93
R7790:Plce1 UTSW 19 38,769,140 (GRCm39) missense probably damaging 0.97
R7921:Plce1 UTSW 19 38,608,997 (GRCm39) missense probably benign 0.03
R8070:Plce1 UTSW 19 38,690,283 (GRCm39) missense probably damaging 0.99
R8087:Plce1 UTSW 19 38,724,965 (GRCm39) missense probably damaging 1.00
R8116:Plce1 UTSW 19 38,513,262 (GRCm39) missense probably benign 0.32
R8178:Plce1 UTSW 19 38,761,423 (GRCm39) missense possibly damaging 0.93
R8321:Plce1 UTSW 19 38,640,380 (GRCm39) missense probably benign 0.00
R8416:Plce1 UTSW 19 38,761,441 (GRCm39) missense possibly damaging 0.77
R8544:Plce1 UTSW 19 38,512,903 (GRCm39) missense probably benign 0.00
R8713:Plce1 UTSW 19 38,513,345 (GRCm39) missense probably benign 0.01
R8850:Plce1 UTSW 19 38,512,811 (GRCm39) missense probably benign
R9217:Plce1 UTSW 19 38,748,551 (GRCm39) missense probably damaging 1.00
R9231:Plce1 UTSW 19 38,705,040 (GRCm39) missense probably benign 0.13
R9232:Plce1 UTSW 19 38,705,423 (GRCm39) missense probably benign 0.16
R9332:Plce1 UTSW 19 38,726,377 (GRCm39) missense probably damaging 1.00
R9473:Plce1 UTSW 19 38,766,337 (GRCm39) missense possibly damaging 0.93
R9474:Plce1 UTSW 19 38,766,337 (GRCm39) missense possibly damaging 0.93
R9475:Plce1 UTSW 19 38,766,337 (GRCm39) missense possibly damaging 0.93
R9476:Plce1 UTSW 19 38,766,337 (GRCm39) missense possibly damaging 0.93
R9751:Plce1 UTSW 19 38,717,414 (GRCm39) missense probably damaging 1.00
R9780:Plce1 UTSW 19 38,609,134 (GRCm39) missense possibly damaging 0.94
R9781:Plce1 UTSW 19 38,513,654 (GRCm39) missense probably damaging 1.00
RF018:Plce1 UTSW 19 38,705,651 (GRCm39) missense probably damaging 0.99
X0022:Plce1 UTSW 19 38,715,443 (GRCm39) missense probably damaging 1.00
X0065:Plce1 UTSW 19 38,766,358 (GRCm39) missense possibly damaging 0.48
Z1176:Plce1 UTSW 19 38,757,904 (GRCm39) missense probably damaging 1.00
Z1176:Plce1 UTSW 19 38,713,424 (GRCm39) nonsense probably null
Z1176:Plce1 UTSW 19 38,690,338 (GRCm39) missense probably damaging 1.00
Z1177:Plce1 UTSW 19 38,640,286 (GRCm39) missense probably null 0.48
Predicted Primers PCR Primer
(F):5'- ATTGAGACCATGCGGAGCCTGAAG -3'
(R):5'- AGTAGCACATTAAGCCTGGCGTAAC -3'

Sequencing Primer
(F):5'- CGGAGCCTGAAGGATGC -3'
(R):5'- AACTTCCAAACGGCTGGTG -3'
Posted On 2014-01-29