Incidental Mutation 'R1224:Ces3a'
ID152837
Institutional Source Beutler Lab
Gene Symbol Ces3a
Ensembl Gene ENSMUSG00000069922
Gene Namecarboxylesterase 3A
SynonymsEs31, Es-male carboxylesterase
MMRRC Submission 039293-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1224 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105048601-105058413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105051509 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 204 (D204V)
Ref Sequence ENSEMBL: ENSMUSP00000090911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093222] [ENSMUST00000093223]
Predicted Effect probably damaging
Transcript: ENSMUST00000093222
AA Change: D204V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090910
Gene: ENSMUSG00000069922
AA Change: D204V

DomainStartEndE-ValueType
Pfam:COesterase 16 547 1.1e-163 PFAM
Pfam:Abhydrolase_3 147 305 5.2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093223
AA Change: D204V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090911
Gene: ENSMUSG00000069922
AA Change: D204V

DomainStartEndE-ValueType
Pfam:COesterase 16 320 1.4e-111 PFAM
Pfam:Abhydrolase_3 147 319 4.8e-14 PFAM
Pfam:COesterase 312 500 1.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213054
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,178,385 C207S probably benign Het
Abca8a T A 11: 110,040,582 E1248D probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Aldh16a1 T C 7: 45,142,047 probably null Het
Aldh9a1 T A 1: 167,352,658 I107N probably damaging Het
Atp6ap1l G A 13: 90,886,556 Q236* probably null Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cd46 A T 1: 195,062,398 I344K possibly damaging Het
Clstn3 T C 6: 124,457,919 S346G probably benign Het
Dock1 A G 7: 135,108,819 D1190G possibly damaging Het
Gimap8 G A 6: 48,650,695 S201N probably benign Het
Gm10153 A G 7: 142,190,335 S19P unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kcng3 A G 17: 83,631,395 L75P probably damaging Het
Krt31 C T 11: 100,049,864 probably null Het
Ly6a A G 15: 74,996,478 V54A possibly damaging Het
Map3k7cl T A 16: 87,556,003 D21E probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Rapsn T C 2: 91,043,198 L230P probably damaging Het
Rhog C A 7: 102,239,752 V165F possibly damaging Het
Slc44a4 T C 17: 34,921,868 V313A probably benign Het
Sox14 G C 9: 99,875,115 H190Q probably damaging Het
Sval2 G A 6: 41,864,254 D103N probably benign Het
Tm9sf3 A T 19: 41,223,195 V403D probably damaging Het
Tmem269 T C 4: 119,217,126 K18R probably benign Het
Unc80 T C 1: 66,471,980 F49S probably damaging Het
Zdhhc7 T A 8: 120,082,572 T299S probably benign Het
Zfp52 T C 17: 21,555,062 V6A possibly damaging Het
Other mutations in Ces3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Ces3a APN 8 105050570 missense probably damaging 1.00
IGL01557:Ces3a APN 8 105057751 missense probably damaging 1.00
IGL02092:Ces3a APN 8 105050330 splice site probably benign
IGL02140:Ces3a APN 8 105055631 missense probably benign 0.07
K3955:Ces3a UTSW 8 105050627 splice site probably benign
R0724:Ces3a UTSW 8 105050195 missense possibly damaging 0.73
R1066:Ces3a UTSW 8 105055656 missense probably benign 0.01
R1223:Ces3a UTSW 8 105058029 missense probably benign 0.00
R1340:Ces3a UTSW 8 105057913 missense probably damaging 1.00
R1513:Ces3a UTSW 8 105050277 missense probably damaging 1.00
R1740:Ces3a UTSW 8 105048685 missense probably damaging 1.00
R2192:Ces3a UTSW 8 105055580 missense probably benign
R3407:Ces3a UTSW 8 105050567 missense probably damaging 1.00
R4002:Ces3a UTSW 8 105057461 missense probably damaging 1.00
R4668:Ces3a UTSW 8 105053423 missense probably damaging 1.00
R5045:Ces3a UTSW 8 105050616 critical splice donor site probably null
R5331:Ces3a UTSW 8 105057556 missense probably damaging 1.00
R5450:Ces3a UTSW 8 105057918 missense possibly damaging 0.83
R5535:Ces3a UTSW 8 105051564 missense probably benign 0.34
R5640:Ces3a UTSW 8 105051745 missense probably benign 0.42
R5881:Ces3a UTSW 8 105050566 missense probably damaging 1.00
R6795:Ces3a UTSW 8 105050596 missense possibly damaging 0.94
R7112:Ces3a UTSW 8 105057962 missense probably damaging 1.00
R7323:Ces3a UTSW 8 105055607 missense possibly damaging 0.54
R7419:Ces3a UTSW 8 105056424 missense probably damaging 1.00
R7793:Ces3a UTSW 8 105055661 critical splice donor site probably null
Z1176:Ces3a UTSW 8 105053602 missense not run
Predicted Primers PCR Primer
(F):5'- ACCATCTAAGAGCCAGCTCTGACTG -3'
(R):5'- AGAATCTTGCTGATGACAACCCCAC -3'

Sequencing Primer
(F):5'- CACATACTAGGAAAACAGGTGATTC -3'
(R):5'- ACTCTGCGATATGGCTCTG -3'
Posted On2014-01-29