Incidental Mutation 'R1224:Olfr1537'
ID152840
Institutional Source Beutler Lab
Gene Symbol Olfr1537
Ensembl Gene ENSMUSG00000096109
Gene Nameolfactory receptor 1537
SynonymsMOR171-41P, MOR171-32P, GA_x6K02T2PVTD-32935684-32934749, Olfr1537-ps1, K4, MOR171-32P, Olfr144
MMRRC Submission 039293-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R1224 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39234412-39249994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 39238251 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 58 (P58A)
Ref Sequence ENSEMBL: ENSMUSP00000149992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073248] [ENSMUST00000213472]
Predicted Effect probably benign
Transcript: ENSMUST00000073248
AA Change: P61A

PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000072979
Gene: ENSMUSG00000096109
AA Change: P61A

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.4e-51 PFAM
Pfam:7tm_1 44 293 1.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213472
AA Change: P58A

PolyPhen 2 Score 0.391 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0728 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,178,385 C207S probably benign Het
Abca8a T A 11: 110,040,582 E1248D probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Aldh16a1 T C 7: 45,142,047 probably null Het
Aldh9a1 T A 1: 167,352,658 I107N probably damaging Het
Atp6ap1l G A 13: 90,886,556 Q236* probably null Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cd46 A T 1: 195,062,398 I344K possibly damaging Het
Ces3a A T 8: 105,051,509 D204V probably damaging Het
Clstn3 T C 6: 124,457,919 S346G probably benign Het
Dock1 A G 7: 135,108,819 D1190G possibly damaging Het
Gimap8 G A 6: 48,650,695 S201N probably benign Het
Gm10153 A G 7: 142,190,335 S19P unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kcng3 A G 17: 83,631,395 L75P probably damaging Het
Krt31 C T 11: 100,049,864 probably null Het
Ly6a A G 15: 74,996,478 V54A possibly damaging Het
Map3k7cl T A 16: 87,556,003 D21E probably benign Het
Rapsn T C 2: 91,043,198 L230P probably damaging Het
Rhog C A 7: 102,239,752 V165F possibly damaging Het
Slc44a4 T C 17: 34,921,868 V313A probably benign Het
Sox14 G C 9: 99,875,115 H190Q probably damaging Het
Sval2 G A 6: 41,864,254 D103N probably benign Het
Tm9sf3 A T 19: 41,223,195 V403D probably damaging Het
Tmem269 T C 4: 119,217,126 K18R probably benign Het
Unc80 T C 1: 66,471,980 F49S probably damaging Het
Zdhhc7 T A 8: 120,082,572 T299S probably benign Het
Zfp52 T C 17: 21,555,062 V6A possibly damaging Het
Other mutations in Olfr1537
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Olfr1537 APN 9 39237605 missense probably benign 0.25
IGL01691:Olfr1537 APN 9 39238019 missense probably benign 0.00
IGL02606:Olfr1537 APN 9 39238194 missense probably damaging 0.98
IGL02656:Olfr1537 APN 9 39238160 missense probably benign 0.13
R0133:Olfr1537 UTSW 9 39238011 missense probably benign 0.00
R0548:Olfr1537 UTSW 9 39238371 missense probably benign 0.13
R0558:Olfr1537 UTSW 9 39238200 missense probably damaging 0.96
R0616:Olfr1537 UTSW 9 39237650 missense probably benign 0.00
R0626:Olfr1537 UTSW 9 39237866 missense possibly damaging 0.52
R0826:Olfr1537 UTSW 9 39238429 start codon destroyed probably null 0.00
R0839:Olfr1537 UTSW 9 39237850 missense possibly damaging 0.51
R1074:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1226:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1252:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1256:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1355:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1356:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1416:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1499:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1658:Olfr1537 UTSW 9 39237959 missense probably benign 0.03
R1815:Olfr1537 UTSW 9 39237990 missense probably benign 0.01
R2198:Olfr1537 UTSW 9 39237752 missense possibly damaging 0.48
R4178:Olfr1537 UTSW 9 39238079 nonsense probably null
R5112:Olfr1537 UTSW 9 39238421 start codon destroyed probably null 0.94
R6251:Olfr1537 UTSW 9 39238218 missense possibly damaging 0.94
R6850:Olfr1537 UTSW 9 39237975 missense probably benign 0.01
R7032:Olfr1537 UTSW 9 39237687 missense possibly damaging 0.73
R7573:Olfr1537 UTSW 9 39237681 missense probably benign 0.42
R7715:Olfr1537 UTSW 9 39237878 missense probably damaging 1.00
R7722:Olfr1537 UTSW 9 39237589 nonsense probably null
R7729:Olfr1537 UTSW 9 39238250 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AACTTGCCCTCCCTGGAGTGAATG -3'
(R):5'- GGAAACCACTGCACAGTGACTGAG -3'

Sequencing Primer
(F):5'- ACATATCGGTCATAGGCCATTGC -3'
(R):5'- ACAGTGACTGAGTTCTTCTTAGC -3'
Posted On2014-01-29