Incidental Mutation 'R1224:Sox14'
ID152841
Institutional Source Beutler Lab
Gene Symbol Sox14
Ensembl Gene ENSMUSG00000053747
Gene NameSRY (sex determining region Y)-box 14
Synonyms
MMRRC Submission 039293-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R1224 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location99874106-99876170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 99875115 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 190 (H190Q)
Ref Sequence ENSEMBL: ENSMUSP00000091310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054819]
Predicted Effect probably damaging
Transcript: ENSMUST00000054819
AA Change: H190Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091310
Gene: ENSMUSG00000053747
AA Change: H190Q

DomainStartEndE-ValueType
HMG 7 77 6.94e-30 SMART
Predicted Effect unknown
Transcript: ENSMUST00000183065
AA Change: H126Q
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. Mutations in this gene are suggested to be responsible for the limb defects associated with blepharophimosis, ptosis, epicanthus inversus syndrome (BPES) and Mobius syndrome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,178,385 C207S probably benign Het
Abca8a T A 11: 110,040,582 E1248D probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Aldh16a1 T C 7: 45,142,047 probably null Het
Aldh9a1 T A 1: 167,352,658 I107N probably damaging Het
Atp6ap1l G A 13: 90,886,556 Q236* probably null Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cd46 A T 1: 195,062,398 I344K possibly damaging Het
Ces3a A T 8: 105,051,509 D204V probably damaging Het
Clstn3 T C 6: 124,457,919 S346G probably benign Het
Dock1 A G 7: 135,108,819 D1190G possibly damaging Het
Gimap8 G A 6: 48,650,695 S201N probably benign Het
Gm10153 A G 7: 142,190,335 S19P unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kcng3 A G 17: 83,631,395 L75P probably damaging Het
Krt31 C T 11: 100,049,864 probably null Het
Ly6a A G 15: 74,996,478 V54A possibly damaging Het
Map3k7cl T A 16: 87,556,003 D21E probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Rapsn T C 2: 91,043,198 L230P probably damaging Het
Rhog C A 7: 102,239,752 V165F possibly damaging Het
Slc44a4 T C 17: 34,921,868 V313A probably benign Het
Sval2 G A 6: 41,864,254 D103N probably benign Het
Tm9sf3 A T 19: 41,223,195 V403D probably damaging Het
Tmem269 T C 4: 119,217,126 K18R probably benign Het
Unc80 T C 1: 66,471,980 F49S probably damaging Het
Zdhhc7 T A 8: 120,082,572 T299S probably benign Het
Zfp52 T C 17: 21,555,062 V6A possibly damaging Het
Other mutations in Sox14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01697:Sox14 APN 9 99875663 missense probably benign 0.45
IGL01766:Sox14 APN 9 99875116 missense probably damaging 1.00
IGL02147:Sox14 APN 9 99875545 missense probably damaging 1.00
IGL03204:Sox14 APN 9 99875057 missense probably benign 0.00
IGL03367:Sox14 APN 9 99875662 missense probably damaging 1.00
R0420:Sox14 UTSW 9 99875122 missense probably damaging 1.00
R3896:Sox14 UTSW 9 99875583 missense probably damaging 1.00
R4081:Sox14 UTSW 9 99875224 missense possibly damaging 0.83
R4611:Sox14 UTSW 9 99875662 missense probably damaging 0.99
R4767:Sox14 UTSW 9 99875633 missense probably damaging 1.00
R4786:Sox14 UTSW 9 99874965 missense probably benign 0.01
R4814:Sox14 UTSW 9 99875231 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTCGAGACTTGCTTTGGGAGAG -3'
(R):5'- GCGCAATTTAGTTCCAGTGCCATC -3'

Sequencing Primer
(F):5'- GGAAAGGATTCAGATCTCTGCTTC -3'
(R):5'- TTAGTTCCAGTGCCATCCAGAAG -3'
Posted On2014-01-29