Incidental Mutation 'R1224:Atp6ap1l'
ID152844
Institutional Source Beutler Lab
Gene Symbol Atp6ap1l
Ensembl Gene ENSMUSG00000078958
Gene NameATPase, H+ transporting, lysosomal accessory protein 1-like
SynonymsEG435376
MMRRC Submission 039293-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R1224 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location90883433-90905355 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 90886556 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 236 (Q236*)
Ref Sequence ENSEMBL: ENSMUSP00000105168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109541] [ENSMUST00000182446]
Predicted Effect probably null
Transcript: ENSMUST00000109541
AA Change: Q236*
SMART Domains Protein: ENSMUSP00000105168
Gene: ENSMUSG00000078958
AA Change: Q236*

DomainStartEndE-ValueType
Pfam:Lamp 19 287 2.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182104
Predicted Effect probably benign
Transcript: ENSMUST00000182446
Predicted Effect probably benign
Transcript: ENSMUST00000183162
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,178,385 C207S probably benign Het
Abca8a T A 11: 110,040,582 E1248D probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Aldh16a1 T C 7: 45,142,047 probably null Het
Aldh9a1 T A 1: 167,352,658 I107N probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cd46 A T 1: 195,062,398 I344K possibly damaging Het
Ces3a A T 8: 105,051,509 D204V probably damaging Het
Clstn3 T C 6: 124,457,919 S346G probably benign Het
Dock1 A G 7: 135,108,819 D1190G possibly damaging Het
Gimap8 G A 6: 48,650,695 S201N probably benign Het
Gm10153 A G 7: 142,190,335 S19P unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kcng3 A G 17: 83,631,395 L75P probably damaging Het
Krt31 C T 11: 100,049,864 probably null Het
Ly6a A G 15: 74,996,478 V54A possibly damaging Het
Map3k7cl T A 16: 87,556,003 D21E probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Rapsn T C 2: 91,043,198 L230P probably damaging Het
Rhog C A 7: 102,239,752 V165F possibly damaging Het
Slc44a4 T C 17: 34,921,868 V313A probably benign Het
Sox14 G C 9: 99,875,115 H190Q probably damaging Het
Sval2 G A 6: 41,864,254 D103N probably benign Het
Tm9sf3 A T 19: 41,223,195 V403D probably damaging Het
Tmem269 T C 4: 119,217,126 K18R probably benign Het
Unc80 T C 1: 66,471,980 F49S probably damaging Het
Zdhhc7 T A 8: 120,082,572 T299S probably benign Het
Zfp52 T C 17: 21,555,062 V6A possibly damaging Het
Other mutations in Atp6ap1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02823:Atp6ap1l APN 13 90899525 missense probably benign 0.00
R0545:Atp6ap1l UTSW 13 90883663 missense probably benign 0.03
R1425:Atp6ap1l UTSW 13 90899519 missense possibly damaging 0.69
R1453:Atp6ap1l UTSW 13 90898747 missense probably benign 0.36
R1784:Atp6ap1l UTSW 13 90905281 missense probably damaging 0.96
R1853:Atp6ap1l UTSW 13 90883588 missense probably damaging 1.00
R1854:Atp6ap1l UTSW 13 90883588 missense probably damaging 1.00
R1932:Atp6ap1l UTSW 13 90883687 missense probably damaging 1.00
R4127:Atp6ap1l UTSW 13 90898707 missense probably damaging 0.98
R5123:Atp6ap1l UTSW 13 90898898 intron probably benign
R5352:Atp6ap1l UTSW 13 90883756 missense probably damaging 1.00
R5746:Atp6ap1l UTSW 13 90883579 missense probably benign
R6492:Atp6ap1l UTSW 13 90883722 missense probably damaging 1.00
R6687:Atp6ap1l UTSW 13 90886723 missense probably benign 0.09
R7150:Atp6ap1l UTSW 13 90883729 missense probably damaging 1.00
R7358:Atp6ap1l UTSW 13 90883807 missense probably damaging 1.00
R7595:Atp6ap1l UTSW 13 90891016 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGTCAGTCACCGGGCTTCAG -3'
(R):5'- TGGTTTAGTTTACACCGCGTCGAG -3'

Sequencing Primer
(F):5'- CTGCACTAGGGTTTAGATAAGTACC -3'
(R):5'- GTTTACACCGCGTCGAGATAATC -3'
Posted On2014-01-29